Incidental Mutation 'R0051:Ecsit'
ID64298
Institutional Source Beutler Lab
Gene Symbol Ecsit
Ensembl Gene ENSMUSG00000066839
Gene NameECSIT signalling integrator
SynonymsSitpec
MMRRC Submission 038345-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0051 (G1)
Quality Score186
Status Validated
Chromosome9
Chromosomal Location22072246-22085438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 22076288 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 152 (V152I)
Ref Sequence ENSEMBL: ENSMUSP00000136247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043922] [ENSMUST00000098937] [ENSMUST00000177967] [ENSMUST00000179422] [ENSMUST00000179605] [ENSMUST00000180180]
Predicted Effect probably benign
Transcript: ENSMUST00000043922
SMART Domains Protein: ENSMUSP00000045895
Gene: ENSMUSG00000038895

DomainStartEndE-ValueType
AT_hook 29 41 2.28e0 SMART
low complexity region 105 116 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 209 232 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
ZnF_C2H2 467 492 4.11e-2 SMART
ZnF_C2H2 498 522 4.47e-3 SMART
ZnF_C2H2 528 550 4.87e-4 SMART
ZnF_C2H2 556 578 2.99e-4 SMART
ZnF_C2H2 586 609 1.31e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098937
AA Change: V152I

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000096537
Gene: ENSMUSG00000066839
AA Change: V152I

DomainStartEndE-ValueType
Pfam:ECSIT 39 267 5e-106 PFAM
ECIST_Cterm 269 394 2.19e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177967
AA Change: V82I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000135936
Gene: ENSMUSG00000066839
AA Change: V82I

DomainStartEndE-ValueType
Pfam:ECSIT 1 197 4.4e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179422
AA Change: V152I

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000137424
Gene: ENSMUSG00000066839
AA Change: V152I

DomainStartEndE-ValueType
Pfam:ECSIT 39 267 5e-106 PFAM
ECIST_Cterm 269 394 2.19e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179605
SMART Domains Protein: ENSMUSP00000137064
Gene: ENSMUSG00000038895

DomainStartEndE-ValueType
AT_hook 29 41 2.28e0 SMART
low complexity region 105 116 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 209 232 N/A INTRINSIC
low complexity region 451 464 N/A INTRINSIC
ZnF_C2H2 475 500 4.11e-2 SMART
ZnF_C2H2 506 530 4.47e-3 SMART
ZnF_C2H2 536 558 4.87e-4 SMART
ZnF_C2H2 564 586 2.99e-4 SMART
ZnF_C2H2 594 617 1.31e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180180
AA Change: V152I

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000136247
Gene: ENSMUSG00000066839
AA Change: V152I

DomainStartEndE-ValueType
Pfam:ECSIT 44 266 6.2e-108 PFAM
ECIST_Cterm 269 394 2.19e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216244
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216270
Meta Mutation Damage Score 0.0829 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Homozygous mutant mice die around the stage of gastrulation showing abnormal epiblast patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,579,101 noncoding transcript Het
Abr T A 11: 76,472,502 Q163L probably benign Het
AI314180 A G 4: 58,832,729 L877S probably damaging Het
Ankrd11 C A 8: 122,889,742 C2457F probably damaging Het
Anks3 G C 16: 4,947,749 T163S probably benign Het
Cacna1d G A 14: 30,111,095 P908S probably damaging Het
Ccdc146 C A 5: 21,316,904 R374L possibly damaging Het
Cdc45 G T 16: 18,794,774 A348E probably damaging Het
Cfap46 A G 7: 139,676,035 C300R probably damaging Het
Coq2 T C 5: 100,663,685 N146S probably benign Het
Dalrd3 T C 9: 108,572,215 V120A possibly damaging Het
Dcp2 T A 18: 44,405,374 probably benign Het
Ddx39 A G 8: 83,720,622 K137R possibly damaging Het
Diaph3 A G 14: 87,037,454 probably null Het
Dmbt1 G T 7: 131,119,496 R1668L possibly damaging Het
Dnah7a T G 1: 53,521,086 probably benign Het
Dpp7 A G 2: 25,356,095 Y49H possibly damaging Het
Drd5 A G 5: 38,320,614 S317G probably benign Het
Emc1 T A 4: 139,375,163 M923K possibly damaging Het
Fam102a G A 2: 32,558,053 R58Q possibly damaging Het
Fcrl6 A T 1: 172,598,753 L159Q probably benign Het
Frrs1 T C 3: 116,885,297 probably benign Het
Hspd1 A G 1: 55,082,046 probably benign Het
Impg2 T A 16: 56,258,048 S458T probably damaging Het
Klf17 T C 4: 117,760,392 Y256C probably damaging Het
Lnx2 A G 5: 147,029,353 F319L probably damaging Het
Mafg G T 11: 120,629,604 R57S probably damaging Het
Med13l T A 5: 118,742,655 W1271R probably damaging Het
Mrgprb1 A G 7: 48,447,214 S24P probably benign Het
Mtrf1l T C 10: 5,813,384 E315G probably damaging Het
Naip1 T C 13: 100,411,001 E1239G probably damaging Het
Ncaph2 T C 15: 89,369,664 S320P probably damaging Het
Nek11 A G 9: 105,218,539 probably benign Het
Nlrp2 A T 7: 5,322,334 probably benign Het
Odf3 C A 7: 140,850,221 probably benign Het
Rbm26 A C 14: 105,152,540 V216G possibly damaging Het
Rnf115 A G 3: 96,785,022 D178G probably damaging Het
Rtel1 C T 2: 181,350,656 Q424* probably null Het
Rwdd4a A G 8: 47,537,365 probably benign Het
Ryr3 T C 2: 112,869,075 D890G probably damaging Het
Scarb1 C A 5: 125,281,100 probably null Het
Serpina10 A G 12: 103,626,897 probably benign Het
Slc12a5 T A 2: 164,986,663 W508R probably damaging Het
Slc43a2 T C 11: 75,562,850 C225R probably damaging Het
Slc6a9 T C 4: 117,864,859 F440L probably damaging Het
Stac3 G A 10: 127,508,148 R305H probably damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Syna A T 5: 134,559,543 L184H probably damaging Het
Tmprss7 T C 16: 45,673,939 N401S probably damaging Het
Yeats2 T A 16: 20,193,724 Y557* probably null Het
Zcchc11 T G 4: 108,527,004 S1089R probably damaging Het
Zfp352 T C 4: 90,224,285 S221P probably damaging Het
Zfp575 A G 7: 24,586,087 V43A probably benign Het
Zfp775 A G 6: 48,620,772 T527A probably benign Het
Other mutations in Ecsit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Ecsit APN 9 22073014 missense probably benign 0.00
IGL02114:Ecsit APN 9 22078144 splice site probably benign
IGL02457:Ecsit APN 9 22078204 missense probably damaging 0.98
IGL03365:Ecsit APN 9 22076526 missense probably damaging 0.99
PIT4458001:Ecsit UTSW 9 22076284 missense probably damaging 1.00
R0051:Ecsit UTSW 9 22076288 missense probably benign 0.01
R0684:Ecsit UTSW 9 22076500 missense probably benign 0.00
R1703:Ecsit UTSW 9 22074811 missense probably damaging 1.00
R1903:Ecsit UTSW 9 22076519 missense possibly damaging 0.74
R1916:Ecsit UTSW 9 22072521 missense probably benign
R2280:Ecsit UTSW 9 22076540 missense possibly damaging 0.73
R2281:Ecsit UTSW 9 22076540 missense possibly damaging 0.73
R5983:Ecsit UTSW 9 22078147 critical splice donor site probably null
R6157:Ecsit UTSW 9 22074691 missense probably damaging 1.00
R6474:Ecsit UTSW 9 22074685 missense possibly damaging 0.91
R7977:Ecsit UTSW 9 22073484 missense probably damaging 1.00
R7987:Ecsit UTSW 9 22073484 missense probably damaging 1.00
R8050:Ecsit UTSW 9 22076296 missense probably benign 0.03
X0024:Ecsit UTSW 9 22074815 critical splice acceptor site probably null
X0025:Ecsit UTSW 9 22072404 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGGAAGCACCCGAGGTTTAGATAC -3'
(R):5'- ACTCGTTCAAGCCATCAGGAAACAG -3'

Sequencing Primer
(F):5'- TGGAGACATCCCAGGTAAGTCC -3'
(R):5'- AAGCTTCCTGAACGCAGTG -3'
Posted On2013-08-06