Mutagenetix > Incidental Mutations

Incidental Mutation 'R0051:Nek11'

64299

Institutional Source

Beutler Lab

Gene Symbol

Nek11

Ensembl Gene

ENSMUSG00000035032

Gene Name

NIMA (never in mitosis gene a)-related expressed kinase 11

Synonyms

4932416N14Rik

MMRRC Submission

038345-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0051 (G1)

Quality Score

110

Status

Validated

Chromosome

Chromosomal Location

105162156-105395524 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 105218539 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000135837 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038648] [ENSMUST00000177029]

Predicted Effect

probably benign
Transcript: ENSMUST00000038648

SMART Domains

Protein: ENSMUSP00000038611
Gene: ENSMUSG00000035032

Domain	Start	End	E-Value	Type
S_TKc	30	288	3.87e-80	SMART
coiled coil region	348	384	N/A	INTRINSIC
low complexity region	408	423	N/A	INTRINSIC
low complexity region	450	466	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177029

SMART Domains

Protein: ENSMUSP00000135837
Gene: ENSMUSG00000035032

Domain	Start	End	E-Value	Type
SCOP:d1h8fa_	11	80	1e-6	SMART
Blast:S_TKc	30	70	1e-11	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215670

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.1%
20x: 93.8%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the never in mitosis gene A family of kinases. The encoded protein localizes to the nucleoli, and may function with NEK2A in the S-phase checkpoint. The encoded protein appears to play roles in DNA replication and response to genotoxic stress. Alternatively spliced transcript variants have been described.[provided by RefSeq, Mar 2009]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	A	G	7: 29,579,101		noncoding transcript	Het
Abr	T	A	11: 76,472,502	Q163L	probably benign	Het
AI314180	A	G	4: 58,832,729	L877S	probably damaging	Het
Ankrd11	C	A	8: 122,889,742	C2457F	probably damaging	Het
Anks3	G	C	16: 4,947,749	T163S	probably benign	Het
Cacna1d	G	A	14: 30,111,095	P908S	probably damaging	Het
Ccdc146	C	A	5: 21,316,904	R374L	possibly damaging	Het
Cdc45	G	T	16: 18,794,774	A348E	probably damaging	Het
Cfap46	A	G	7: 139,676,035	C300R	probably damaging	Het
Coq2	T	C	5: 100,663,685	N146S	probably benign	Het
Dalrd3	T	C	9: 108,572,215	V120A	possibly damaging	Het
Dcp2	T	A	18: 44,405,374		probably benign	Het
Ddx39	A	G	8: 83,720,622	K137R	possibly damaging	Het
Diaph3	A	G	14: 87,037,454		probably null	Het
Dmbt1	G	T	7: 131,119,496	R1668L	possibly damaging	Het
Dnah7a	T	G	1: 53,521,086		probably benign	Het
Dpp7	A	G	2: 25,356,095	Y49H	possibly damaging	Het
Drd5	A	G	5: 38,320,614	S317G	probably benign	Het
Ecsit	C	T	9: 22,076,288	V152I	probably benign	Het
Emc1	T	A	4: 139,375,163	M923K	possibly damaging	Het
Fam102a	G	A	2: 32,558,053	R58Q	possibly damaging	Het
Fcrl6	A	T	1: 172,598,753	L159Q	probably benign	Het
Frrs1	T	C	3: 116,885,297		probably benign	Het
Hspd1	A	G	1: 55,082,046		probably benign	Het
Impg2	T	A	16: 56,258,048	S458T	probably damaging	Het
Klf17	T	C	4: 117,760,392	Y256C	probably damaging	Het
Lnx2	A	G	5: 147,029,353	F319L	probably damaging	Het
Mafg	G	T	11: 120,629,604	R57S	probably damaging	Het
Med13l	T	A	5: 118,742,655	W1271R	probably damaging	Het
Mrgprb1	A	G	7: 48,447,214	S24P	probably benign	Het
Mtrf1l	T	C	10: 5,813,384	E315G	probably damaging	Het
Naip1	T	C	13: 100,411,001	E1239G	probably damaging	Het
Ncaph2	T	C	15: 89,369,664	S320P	probably damaging	Het
Nlrp2	A	T	7: 5,322,334		probably benign	Het
Odf3	C	A	7: 140,850,221		probably benign	Het
Rbm26	A	C	14: 105,152,540	V216G	possibly damaging	Het
Rnf115	A	G	3: 96,785,022	D178G	probably damaging	Het
Rtel1	C	T	2: 181,350,656	Q424*	probably null	Het
Rwdd4a	A	G	8: 47,537,365		probably benign	Het
Ryr3	T	C	2: 112,869,075	D890G	probably damaging	Het
Scarb1	C	A	5: 125,281,100		probably null	Het
Serpina10	A	G	12: 103,626,897		probably benign	Het
Slc12a5	T	A	2: 164,986,663	W508R	probably damaging	Het
Slc43a2	T	C	11: 75,562,850	C225R	probably damaging	Het
Slc6a9	T	C	4: 117,864,859	F440L	probably damaging	Het
Stac3	G	A	10: 127,508,148	R305H	probably damaging	Het
Stk32b	A	G	5: 37,459,596		probably benign	Het
Syna	A	T	5: 134,559,543	L184H	probably damaging	Het
Tmprss7	T	C	16: 45,673,939	N401S	probably damaging	Het
Yeats2	T	A	16: 20,193,724	Y557*	probably null	Het
Zcchc11	T	G	4: 108,527,004	S1089R	probably damaging	Het
Zfp352	T	C	4: 90,224,285	S221P	probably damaging	Het
Zfp575	A	G	7: 24,586,087	V43A	probably benign	Het
Zfp775	A	G	6: 48,620,772	T527A	probably benign	Het

Other mutations in Nek11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01348:Nek11	APN	9	105392913	missense	probably damaging	1.00
IGL01369:Nek11	APN	9	105300060	critical splice donor site	probably null
IGL01958:Nek11	APN	9	105300303	missense	probably benign	0.06
IGL03099:Nek11	APN	9	105287653	missense	probably benign	0.02
IGL03256:Nek11	APN	9	105244414	missense	probably damaging	1.00
IGL03400:Nek11	APN	9	105204866	missense	probably benign	0.01
R0051:Nek11	UTSW	9	105218539	splice site	probably benign
R0194:Nek11	UTSW	9	105392952	missense	probably benign	0.05
R0942:Nek11	UTSW	9	105295371	unclassified	probably null
R1226:Nek11	UTSW	9	105392892	missense	probably damaging	1.00
R1503:Nek11	UTSW	9	105163204	missense	probably damaging	1.00
R1709:Nek11	UTSW	9	105348061	missense	probably damaging	1.00
R1958:Nek11	UTSW	9	105293717	missense	probably benign	0.00
R2128:Nek11	UTSW	9	105300361	missense	probably benign	0.01
R3754:Nek11	UTSW	9	105314718	missense	probably damaging	1.00
R4027:Nek11	UTSW	9	105244390	nonsense	probably null
R4594:Nek11	UTSW	9	105392847	critical splice donor site	probably null
R4650:Nek11	UTSW	9	105348080	missense	possibly damaging	0.79
R4724:Nek11	UTSW	9	105392970	missense	possibly damaging	0.89
R4846:Nek11	UTSW	9	105163163	missense	probably damaging	1.00
R4903:Nek11	UTSW	9	105314722	missense	possibly damaging	0.63
R4908:Nek11	UTSW	9	105298289	missense	probably benign	0.00
R4912:Nek11	UTSW	9	105287658	missense	probably benign	0.01
R4930:Nek11	UTSW	9	105300066	missense	probably damaging	1.00
R5827:Nek11	UTSW	9	105314745	missense	probably damaging	1.00
R5860:Nek11	UTSW	9	105392961	missense	probably benign	0.01
R6030:Nek11	UTSW	9	105204888	critical splice acceptor site	probably null
R6030:Nek11	UTSW	9	105204888	critical splice acceptor site	probably null
R6154:Nek11	UTSW	9	105323169	makesense	probably null
R6915:Nek11	UTSW	9	105393057	unclassified	probably benign
R7197:Nek11	UTSW	9	105244415	missense	probably damaging	1.00
R8059:Nek11	UTSW	9	105162974	makesense	probably null
R8140:Nek11	UTSW	9	105392957	missense	probably damaging	0.99
R8357:Nek11	UTSW	9	105347992	missense	probably damaging	1.00
Z1176:Nek11	UTSW	9	105293669	missense	probably benign	0.28

Predicted Primers

PCR Primer
(F):5'- AATGTACTATGCACTGCCAGGCTG -3'
(R):5'- TGTAGAGCCTTGCACTCCCCAAAC -3'

Sequencing Primer
(F):5'- ATTTACTTCATTCTTCAAGGCTGG -3'
(R):5'- GGGATCTACAGATTGGTACACACAC -3'

Posted On

2013-08-06