Incidental Mutation 'R0051:Mtrf1l'
ID64300
Institutional Source Beutler Lab
Gene Symbol Mtrf1l
Ensembl Gene ENSMUSG00000019774
Gene Namemitochondrial translational release factor 1-like
Synonyms9130004K12Rik
MMRRC Submission 038345-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0051 (G1)
Quality Score109
Status Validated
Chromosome10
Chromosomal Location5811887-5823910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5813384 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 315 (E315G)
Ref Sequence ENSEMBL: ENSMUSP00000019908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019908]
Predicted Effect probably damaging
Transcript: ENSMUST00000019908
AA Change: E315G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019908
Gene: ENSMUSG00000019774
AA Change: E315G

DomainStartEndE-ValueType
PCRF 75 189 2.26e-36 SMART
Pfam:RF-1 221 331 1.5e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145718
Meta Mutation Damage Score 0.6454 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a role in mitochondrial translation termination, and is thought to be a release factor that is involved in the dissociation of the complete protein from the final tRNA, the ribosome, and the cognate mRNA. This protein acts upon UAA and UAG stop codons, but has no in vitro activity against UGA, which encodes tryptophan in human mitochondrion, or, the mitochondrial non-cognate stop codons, AGA and AGG. This protein shares sequence similarity to bacterial release factors. Pseudogenes of this gene are found on chromosomes 4, 8, and 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,579,101 noncoding transcript Het
Abr T A 11: 76,472,502 Q163L probably benign Het
AI314180 A G 4: 58,832,729 L877S probably damaging Het
Ankrd11 C A 8: 122,889,742 C2457F probably damaging Het
Anks3 G C 16: 4,947,749 T163S probably benign Het
Cacna1d G A 14: 30,111,095 P908S probably damaging Het
Ccdc146 C A 5: 21,316,904 R374L possibly damaging Het
Cdc45 G T 16: 18,794,774 A348E probably damaging Het
Cfap46 A G 7: 139,676,035 C300R probably damaging Het
Coq2 T C 5: 100,663,685 N146S probably benign Het
Dalrd3 T C 9: 108,572,215 V120A possibly damaging Het
Dcp2 T A 18: 44,405,374 probably benign Het
Ddx39 A G 8: 83,720,622 K137R possibly damaging Het
Diaph3 A G 14: 87,037,454 probably null Het
Dmbt1 G T 7: 131,119,496 R1668L possibly damaging Het
Dnah7a T G 1: 53,521,086 probably benign Het
Dpp7 A G 2: 25,356,095 Y49H possibly damaging Het
Drd5 A G 5: 38,320,614 S317G probably benign Het
Ecsit C T 9: 22,076,288 V152I probably benign Het
Emc1 T A 4: 139,375,163 M923K possibly damaging Het
Fam102a G A 2: 32,558,053 R58Q possibly damaging Het
Fcrl6 A T 1: 172,598,753 L159Q probably benign Het
Frrs1 T C 3: 116,885,297 probably benign Het
Hspd1 A G 1: 55,082,046 probably benign Het
Impg2 T A 16: 56,258,048 S458T probably damaging Het
Klf17 T C 4: 117,760,392 Y256C probably damaging Het
Lnx2 A G 5: 147,029,353 F319L probably damaging Het
Mafg G T 11: 120,629,604 R57S probably damaging Het
Med13l T A 5: 118,742,655 W1271R probably damaging Het
Mrgprb1 A G 7: 48,447,214 S24P probably benign Het
Naip1 T C 13: 100,411,001 E1239G probably damaging Het
Ncaph2 T C 15: 89,369,664 S320P probably damaging Het
Nek11 A G 9: 105,218,539 probably benign Het
Nlrp2 A T 7: 5,322,334 probably benign Het
Odf3 C A 7: 140,850,221 probably benign Het
Rbm26 A C 14: 105,152,540 V216G possibly damaging Het
Rnf115 A G 3: 96,785,022 D178G probably damaging Het
Rtel1 C T 2: 181,350,656 Q424* probably null Het
Rwdd4a A G 8: 47,537,365 probably benign Het
Ryr3 T C 2: 112,869,075 D890G probably damaging Het
Scarb1 C A 5: 125,281,100 probably null Het
Serpina10 A G 12: 103,626,897 probably benign Het
Slc12a5 T A 2: 164,986,663 W508R probably damaging Het
Slc43a2 T C 11: 75,562,850 C225R probably damaging Het
Slc6a9 T C 4: 117,864,859 F440L probably damaging Het
Stac3 G A 10: 127,508,148 R305H probably damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Syna A T 5: 134,559,543 L184H probably damaging Het
Tmprss7 T C 16: 45,673,939 N401S probably damaging Het
Yeats2 T A 16: 20,193,724 Y557* probably null Het
Zcchc11 T G 4: 108,527,004 S1089R probably damaging Het
Zfp352 T C 4: 90,224,285 S221P probably damaging Het
Zfp575 A G 7: 24,586,087 V43A probably benign Het
Zfp775 A G 6: 48,620,772 T527A probably benign Het
Other mutations in Mtrf1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Mtrf1l APN 10 5814180 splice site probably benign
IGL01292:Mtrf1l APN 10 5814090 missense probably benign 0.00
IGL01844:Mtrf1l APN 10 5814112 missense probably null 0.76
R0050:Mtrf1l UTSW 10 5815553 splice site silent
R0051:Mtrf1l UTSW 10 5813382 missense probably damaging 1.00
R0866:Mtrf1l UTSW 10 5813376 missense probably damaging 1.00
R1636:Mtrf1l UTSW 10 5813265 missense probably damaging 0.98
R2897:Mtrf1l UTSW 10 5817565 missense probably benign 0.16
R4020:Mtrf1l UTSW 10 5817454 missense probably benign 0.01
R4618:Mtrf1l UTSW 10 5817586 missense probably benign 0.37
R4843:Mtrf1l UTSW 10 5823696 missense possibly damaging 0.56
R6034:Mtrf1l UTSW 10 5823834 unclassified probably benign
R6034:Mtrf1l UTSW 10 5823834 unclassified probably benign
R6261:Mtrf1l UTSW 10 5815550 critical splice donor site probably null
R6345:Mtrf1l UTSW 10 5817468 missense possibly damaging 0.96
R6991:Mtrf1l UTSW 10 5813384 missense probably damaging 1.00
R7669:Mtrf1l UTSW 10 5815620 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTCATAATCCGAACAGTCCTTCAG -3'
(R):5'- TCGCCACAACAGGATGACTTTAATTCC -3'

Sequencing Primer
(F):5'- GAACAGTCCTTCAGTGACTGAATC -3'
(R):5'- CCTTAAGTCATGGAGCATTGAAAG -3'
Posted On2013-08-06