Incidental Mutation 'BB018:Flt1'
ID643005
Institutional Source Beutler Lab
Gene Symbol Flt1
Ensembl Gene ENSMUSG00000029648
Gene NameFMS-like tyrosine kinase 1
SynonymsFlt-1, VEGFR1, vascular endothelial growth factor receptor-1, sFlt1, VEGFR-1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #BB018
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location147561604-147726011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 147588572 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 919 (S919P)
Ref Sequence ENSEMBL: ENSMUSP00000031653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031653]
Predicted Effect probably damaging
Transcript: ENSMUST00000031653
AA Change: S919P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031653
Gene: ENSMUSG00000029648
AA Change: S919P

DomainStartEndE-ValueType
IG 38 130 1.74e-3 SMART
IG 144 225 1.49e-2 SMART
IG 238 330 2.23e-10 SMART
IG 345 426 2.43e-2 SMART
IG 440 554 2.6e-2 SMART
IGc2 569 644 1.76e-8 SMART
IGc2 674 739 6.29e-19 SMART
low complexity region 769 786 N/A INTRINSIC
TyrKc 828 1154 9.54e-144 SMART
Meta Mutation Damage Score 0.7897 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vascular endothelial growth factor receptor (VEGFR) family. VEGFR family members are receptor tyrosine kinases (RTKs) which contain an extracellular ligand-binding region with seven immunoglobulin (Ig)-like domains, a transmembrane segment, and a tyrosine kinase (TK) domain within the cytoplasmic domain. This protein binds to VEGFR-A, VEGFR-B and placental growth factor and plays an important role in angiogenesis and vasculogenesis. Expression of this receptor is found in vascular endothelial cells, placental trophoblast cells and peripheral blood monocytes. Multiple transcript variants encoding different isoforms have been found for this gene. Isoforms include a full-length transmembrane receptor isoform and shortened, soluble isoforms. The soluble isoforms are associated with the onset of pre-eclampsia.[provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit an excess of hemangioblasts resulting in an overgrowth of endothelial cells, abnormalities of vascular channels and blood islands, and lethality at the mid-somite developmental stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp2 A T 2: 91,206,715 probably null Het
Aire G A 10: 78,030,296 A536V probably damaging Het
Aox4 A G 1: 58,255,486 I951M probably benign Het
Ash1l G T 3: 89,043,541 C2190F probably damaging Het
C1s1 C T 6: 124,533,400 V363M probably damaging Het
Diaph3 A T 14: 87,115,020 D48E possibly damaging Het
Dnajc13 A G 9: 104,218,564 V559A probably benign Het
Dzank1 T C 2: 144,481,694 I610V probably benign Het
F7 A G 8: 13,035,209 I412V probably benign Het
Gm13212 G A 4: 145,622,556 D188N possibly damaging Het
Igkv4-70 C A 6: 69,267,991 R82L probably damaging Het
Lnp1 T A 16: 56,927,918 R4* probably null Het
Lrrc3b T C 14: 15,358,018 N196S probably benign Het
Mlxip A G 5: 123,450,495 D816G probably damaging Het
Myh7 C T 14: 54,983,662 E935K possibly damaging Het
Myom3 A T 4: 135,789,636 H839L probably benign Het
Nebl C T 2: 17,376,622 probably null Het
Ninj1 T C 13: 49,193,956 I99T probably damaging Het
Olfr1249 T A 2: 89,630,104 I265F possibly damaging Het
Olfr167 A G 16: 19,515,508 S43P possibly damaging Het
Olfr738 A C 14: 50,414,329 M262L probably damaging Het
Olfr972 A T 9: 39,873,850 T192S possibly damaging Het
Otop1 A G 5: 38,288,020 H174R probably damaging Het
Pcdhb16 A G 18: 37,478,457 N157D possibly damaging Het
Prss44 A C 9: 110,814,678 Q130P probably damaging Het
Ptpn4 T A 1: 119,680,195 M712L probably damaging Het
Ptprh C A 7: 4,571,988 S344I probably benign Het
Rps6kl1 T C 12: 85,149,792 I33V possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Scn1a T C 2: 66,317,812 S110G probably damaging Het
Sdk2 C A 11: 113,893,441 K157N possibly damaging Het
Serpina1d A T 12: 103,767,556 V163D probably damaging Het
Serpina3g T C 12: 104,239,169 S56P probably benign Het
Slc4a4 T C 5: 89,170,781 L636P probably benign Het
Slc6a1 T C 6: 114,311,902 F474S probably benign Het
Slco6d1 A G 1: 98,428,416 D235G probably damaging Het
Srgn A T 10: 62,494,984 M114K possibly damaging Het
Syne3 A T 12: 104,963,232 V243E probably damaging Het
Tcf19 A G 17: 35,514,907 F118L probably damaging Het
Tln2 A T 9: 67,258,460 probably null Het
Tnxb A G 17: 34,688,698 T1239A probably damaging Het
Traip A G 9: 107,971,042 I453M probably benign Het
Vmn1r157 C T 7: 22,761,785 A30V probably damaging Het
Vmn1r233 G A 17: 20,993,863 A275V probably benign Het
Vps13d G A 4: 145,096,284 R2976* probably null Het
Wdr75 T C 1: 45,819,635 F655L probably benign Het
Wwp1 A G 4: 19,650,114 probably null Het
Zc3h4 T C 7: 16,432,984 L747P unknown Het
Other mutations in Flt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Flt1 APN 5 147580300 critical splice donor site probably null
IGL00469:Flt1 APN 5 147603605 missense probably damaging 0.99
IGL00897:Flt1 APN 5 147589854 missense probably benign 0.25
IGL01111:Flt1 APN 5 147578336 missense probably damaging 1.00
IGL01154:Flt1 APN 5 147576156 missense possibly damaging 0.63
IGL01744:Flt1 APN 5 147571461 missense probably benign 0.01
IGL01973:Flt1 APN 5 147683889 missense probably benign 0.01
IGL02079:Flt1 APN 5 147568831 splice site probably benign
IGL02143:Flt1 APN 5 147578436 missense probably benign 0.00
IGL02156:Flt1 APN 5 147681741 missense probably damaging 0.99
IGL02345:Flt1 APN 5 147582626 missense probably benign 0.20
IGL02548:Flt1 APN 5 147639248 missense probably benign 0.00
IGL02631:Flt1 APN 5 147673574 nonsense probably null
IGL02686:Flt1 APN 5 147588602 missense probably damaging 1.00
IGL02938:Flt1 APN 5 147678299 missense possibly damaging 0.47
IGL03057:Flt1 APN 5 147681924 nonsense probably null
IGL03196:Flt1 APN 5 147615127 critical splice donor site probably null
IGL03205:Flt1 APN 5 147699821 missense probably benign 0.00
IGL03255:Flt1 APN 5 147588521 splice site probably benign
flywheels UTSW 5 147599646 missense probably damaging 1.00
BB008:Flt1 UTSW 5 147588572 missense probably damaging 1.00
IGL02837:Flt1 UTSW 5 147655170 missense probably benign 0.32
PIT4402001:Flt1 UTSW 5 147678239 missense probably damaging 1.00
R0013:Flt1 UTSW 5 147571014 splice site probably benign
R0380:Flt1 UTSW 5 147588572 missense probably damaging 1.00
R0448:Flt1 UTSW 5 147566394 splice site probably benign
R0789:Flt1 UTSW 5 147639483 missense probably damaging 1.00
R1005:Flt1 UTSW 5 147681885 missense probably damaging 0.99
R1241:Flt1 UTSW 5 147599646 missense probably damaging 1.00
R1302:Flt1 UTSW 5 147564240 missense possibly damaging 0.93
R1411:Flt1 UTSW 5 147580316 missense probably damaging 1.00
R1615:Flt1 UTSW 5 147639288 missense probably damaging 1.00
R1634:Flt1 UTSW 5 147676430 missense probably damaging 1.00
R1749:Flt1 UTSW 5 147655119 missense probably benign 0.00
R1768:Flt1 UTSW 5 147672709 missense probably damaging 1.00
R1972:Flt1 UTSW 5 147655093 splice site probably benign
R2074:Flt1 UTSW 5 147599606 missense possibly damaging 0.82
R2081:Flt1 UTSW 5 147639422 missense probably damaging 1.00
R2864:Flt1 UTSW 5 147594621 missense possibly damaging 0.68
R2865:Flt1 UTSW 5 147594621 missense possibly damaging 0.68
R3740:Flt1 UTSW 5 147599593 missense probably damaging 1.00
R3820:Flt1 UTSW 5 147700017 splice site probably benign
R4089:Flt1 UTSW 5 147564241 missense probably benign 0.03
R4299:Flt1 UTSW 5 147683907 missense probably benign 0.00
R4570:Flt1 UTSW 5 147594613 missense probably damaging 1.00
R4812:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4853:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4865:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4900:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4906:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4907:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4909:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5072:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5073:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5074:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5218:Flt1 UTSW 5 147681928 missense probably damaging 1.00
R5547:Flt1 UTSW 5 147655138 missense probably damaging 1.00
R5731:Flt1 UTSW 5 147678152 missense probably benign 0.16
R5732:Flt1 UTSW 5 147634483 nonsense probably null
R5804:Flt1 UTSW 5 147580437 splice site probably null
R6107:Flt1 UTSW 5 147603593 missense probably benign 0.15
R6440:Flt1 UTSW 5 147564305 missense possibly damaging 0.79
R6453:Flt1 UTSW 5 147683941 missense possibly damaging 0.80
R6539:Flt1 UTSW 5 147578376 missense probably benign 0.27
R7068:Flt1 UTSW 5 147673634 missense probably damaging 1.00
R7112:Flt1 UTSW 5 147603569 missense probably damaging 1.00
R7195:Flt1 UTSW 5 147603576 missense probably damaging 1.00
R7255:Flt1 UTSW 5 147580406 missense probably damaging 1.00
R7347:Flt1 UTSW 5 147580381 missense probably damaging 1.00
R7469:Flt1 UTSW 5 147603569 missense probably damaging 1.00
R7473:Flt1 UTSW 5 147594595 missense probably damaging 1.00
R7663:Flt1 UTSW 5 147655120 missense probably benign
R7688:Flt1 UTSW 5 147676325 missense probably benign
R7729:Flt1 UTSW 5 147700367 missense probably benign 0.00
R7931:Flt1 UTSW 5 147588572 missense probably damaging 1.00
R8051:Flt1 UTSW 5 147582691 missense probably benign 0.02
R8275:Flt1 UTSW 5 147678147 missense probably damaging 0.99
X0064:Flt1 UTSW 5 147673613 missense probably damaging 1.00
Z1088:Flt1 UTSW 5 147681649 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ACAGCCATACCTTTAGAATCTAGGC -3'
(R):5'- TCTAGTCTCAGGTGCACTCTCG -3'

Sequencing Primer
(F):5'- ACCTTTAGAATCTAGGCCTGGCTAG -3'
(R):5'- TGCACTCTCGGGCCCTAC -3'
Posted On2020-08-01