Mutagenetix > Incidental Mutations

Incidental Mutation 'R0051:Stac3'

64301

Institutional Source

Beutler Lab

Gene Symbol

Stac3

Ensembl Gene

ENSMUSG00000040287

Gene Name

SH3 and cysteine rich domain 3

Synonyms

MMRRC Submission

038345-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0051 (G1)

Quality Score

165

Status

Validated

Chromosome

Chromosomal Location

127501686-127508823 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 127508148 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 305 (R305H)

Ref Sequence

ENSEMBL: ENSMUSP00000125124 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035839] [ENSMUST00000160019]

Predicted Effect

probably damaging
Transcript: ENSMUST00000035839
AA Change: R305H

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000048148
Gene: ENSMUSG00000040287
AA Change: R305H

Domain	Start	End	E-Value	Type
low complexity region	35	46	N/A	INTRINSIC
low complexity region	65	81	N/A	INTRINSIC
C1	89	139	2.19e-7	SMART
low complexity region	199	213	N/A	INTRINSIC
low complexity region	220	238	N/A	INTRINSIC
SH3	246	301	1.41e-16	SMART
SH3	305	360	8.45e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000160019
AA Change: R305H

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000125124
Gene: ENSMUSG00000040287
AA Change: R305H

Domain	Start	End	E-Value	Type
low complexity region	35	46	N/A	INTRINSIC
low complexity region	65	81	N/A	INTRINSIC
C1	89	139	2.19e-7	SMART
low complexity region	199	213	N/A	INTRINSIC
low complexity region	220	238	N/A	INTRINSIC
SH3	246	301	1.41e-16	SMART
SH3	305	360	8.45e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160760

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162302

Meta Mutation Damage Score

0.4147

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.1%
20x: 93.8%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the excitation-contraction coupling machinery of muscles. This protein is a member of the Stac gene family and contains an N-terminal cysteine-rich domain and two SH3 domains. Mutations in this gene are a cause of Native American myopathy. [provided by RefSeq, Nov 2013]
PHENOTYPE: Homozygous inactivation of this gene leads to neonatal lethality, abnormal posture, thin diaphragm muscle, abnormal skeletal muscle morphology characterized by centralized nuclei and disorganized myofibrils, and impaired skeletal muscle contractility due to defective excitation-contraction coupling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	A	G	7: 29,579,101		noncoding transcript	Het
Abr	T	A	11: 76,472,502	Q163L	probably benign	Het
AI314180	A	G	4: 58,832,729	L877S	probably damaging	Het
Ankrd11	C	A	8: 122,889,742	C2457F	probably damaging	Het
Anks3	G	C	16: 4,947,749	T163S	probably benign	Het
Cacna1d	G	A	14: 30,111,095	P908S	probably damaging	Het
Ccdc146	C	A	5: 21,316,904	R374L	possibly damaging	Het
Cdc45	G	T	16: 18,794,774	A348E	probably damaging	Het
Cfap46	A	G	7: 139,676,035	C300R	probably damaging	Het
Coq2	T	C	5: 100,663,685	N146S	probably benign	Het
Dalrd3	T	C	9: 108,572,215	V120A	possibly damaging	Het
Dcp2	T	A	18: 44,405,374		probably benign	Het
Ddx39	A	G	8: 83,720,622	K137R	possibly damaging	Het
Diaph3	A	G	14: 87,037,454		probably null	Het
Dmbt1	G	T	7: 131,119,496	R1668L	possibly damaging	Het
Dnah7a	T	G	1: 53,521,086		probably benign	Het
Dpp7	A	G	2: 25,356,095	Y49H	possibly damaging	Het
Drd5	A	G	5: 38,320,614	S317G	probably benign	Het
Ecsit	C	T	9: 22,076,288	V152I	probably benign	Het
Emc1	T	A	4: 139,375,163	M923K	possibly damaging	Het
Fam102a	G	A	2: 32,558,053	R58Q	possibly damaging	Het
Fcrl6	A	T	1: 172,598,753	L159Q	probably benign	Het
Frrs1	T	C	3: 116,885,297		probably benign	Het
Hspd1	A	G	1: 55,082,046		probably benign	Het
Impg2	T	A	16: 56,258,048	S458T	probably damaging	Het
Klf17	T	C	4: 117,760,392	Y256C	probably damaging	Het
Lnx2	A	G	5: 147,029,353	F319L	probably damaging	Het
Mafg	G	T	11: 120,629,604	R57S	probably damaging	Het
Med13l	T	A	5: 118,742,655	W1271R	probably damaging	Het
Mrgprb1	A	G	7: 48,447,214	S24P	probably benign	Het
Mtrf1l	T	C	10: 5,813,384	E315G	probably damaging	Het
Naip1	T	C	13: 100,411,001	E1239G	probably damaging	Het
Ncaph2	T	C	15: 89,369,664	S320P	probably damaging	Het
Nek11	A	G	9: 105,218,539		probably benign	Het
Nlrp2	A	T	7: 5,322,334		probably benign	Het
Odf3	C	A	7: 140,850,221		probably benign	Het
Rbm26	A	C	14: 105,152,540	V216G	possibly damaging	Het
Rnf115	A	G	3: 96,785,022	D178G	probably damaging	Het
Rtel1	C	T	2: 181,350,656	Q424*	probably null	Het
Rwdd4a	A	G	8: 47,537,365		probably benign	Het
Ryr3	T	C	2: 112,869,075	D890G	probably damaging	Het
Scarb1	C	A	5: 125,281,100		probably null	Het
Serpina10	A	G	12: 103,626,897		probably benign	Het
Slc12a5	T	A	2: 164,986,663	W508R	probably damaging	Het
Slc43a2	T	C	11: 75,562,850	C225R	probably damaging	Het
Slc6a9	T	C	4: 117,864,859	F440L	probably damaging	Het
Stk32b	A	G	5: 37,459,596		probably benign	Het
Syna	A	T	5: 134,559,543	L184H	probably damaging	Het
Tmprss7	T	C	16: 45,673,939	N401S	probably damaging	Het
Yeats2	T	A	16: 20,193,724	Y557*	probably null	Het
Zcchc11	T	G	4: 108,527,004	S1089R	probably damaging	Het
Zfp352	T	C	4: 90,224,285	S221P	probably damaging	Het
Zfp575	A	G	7: 24,586,087	V43A	probably benign	Het
Zfp775	A	G	6: 48,620,772	T527A	probably benign	Het

Other mutations in Stac3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00497:Stac3	APN	10	127503664	missense	probably damaging	1.00
IGL02271:Stac3	APN	10	127503899	missense	probably benign	0.00
R0090:Stac3	UTSW	10	127503930	unclassified	probably benign
R0131:Stac3	UTSW	10	127503650	missense	probably damaging	0.97
R0131:Stac3	UTSW	10	127503650	missense	probably damaging	0.97
R0132:Stac3	UTSW	10	127503650	missense	probably damaging	0.97
R0330:Stac3	UTSW	10	127507747	splice site	probably null
R0630:Stac3	UTSW	10	127507763	missense	probably damaging	1.00
R1132:Stac3	UTSW	10	127507259	missense	probably benign
R1450:Stac3	UTSW	10	127504885	missense	probably damaging	1.00
R1739:Stac3	UTSW	10	127507766	missense	probably benign	0.40
R2316:Stac3	UTSW	10	127503360	splice site	probably null
R2511:Stac3	UTSW	10	127503918	critical splice donor site	probably null
R3000:Stac3	UTSW	10	127508147	missense	probably benign	0.01
R4324:Stac3	UTSW	10	127503249	missense	probably damaging	0.99
R4758:Stac3	UTSW	10	127503345	missense	possibly damaging	0.95
R5040:Stac3	UTSW	10	127508124	missense	probably damaging	0.98
R6244:Stac3	UTSW	10	127508175	missense	probably damaging	1.00
R6275:Stac3	UTSW	10	127507746	nonsense	probably null
R7335:Stac3	UTSW	10	127504900	missense	probably benign	0.22
R8191:Stac3	UTSW	10	127508199	missense	probably damaging	1.00
R8290:Stac3	UTSW	10	127503360	splice site	probably null
R8410:Stac3	UTSW	10	127503330	missense	probably damaging	1.00
R8690:Stac3	UTSW	10	127503625	missense	probably damaging	1.00
R8799:Stac3	UTSW	10	127504912	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GGCACGGGCATGTGACTGTAAATC -3'
(R):5'- CCTTGACGTAACCACCAGCTTCATC -3'

Sequencing Primer
(F):5'- CTGTAAATCACAGAGAGGGTCTCC -3'
(R):5'- TCTGCACTACGATCTAGGGG -3'

Posted On

2013-08-06