Mutagenetix > Incidental Mutations

Incidental Mutation 'R0051:Slc43a2'

64302

Institutional Source

Beutler Lab

Gene Symbol

Slc43a2

Ensembl Gene

ENSMUSG00000038178

Gene Name

solute carrier family 43, member 2

Synonyms

7630402D21Rik

MMRRC Submission

038345-MU

Accession Numbers

Genbank: NM_001199283.1, NM_001199284.1, NM_173388.2; Ensembl: ENSMUST00000042561

Is this an essential gene?

Possibly essential (E-score: 0.645) question?

Stock #

R0051 (G1)

Quality Score

144

Status

Validated

Chromosome

Chromosomal Location

75531694-75577575 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 75562850 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 225 (C225R)

Ref Sequence

ENSEMBL: ENSMUSP00000126838 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042561] [ENSMUST00000108433] [ENSMUST00000169547]

Predicted Effect

probably damaging
Transcript: ENSMUST00000042561
AA Change: C225R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000046074
Gene: ENSMUSG00000038178
AA Change: C225R

Domain	Start	End	E-Value	Type
transmembrane domain	20	39	N/A	INTRINSIC
Pfam:MFS_1	58	393	2.9e-15	PFAM
transmembrane domain	426	448	N/A	INTRINSIC
transmembrane domain	453	475	N/A	INTRINSIC
transmembrane domain	482	504	N/A	INTRINSIC
transmembrane domain	514	536	N/A	INTRINSIC
low complexity region	538	550	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108433
AA Change: C225R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000104071
Gene: ENSMUSG00000038178
AA Change: C225R

Domain	Start	End	E-Value	Type
transmembrane domain	20	39	N/A	INTRINSIC
Pfam:MFS_1	58	393	2.4e-15	PFAM
transmembrane domain	426	448	N/A	INTRINSIC
transmembrane domain	453	475	N/A	INTRINSIC
transmembrane domain	482	504	N/A	INTRINSIC
transmembrane domain	514	536	N/A	INTRINSIC
low complexity region	538	550	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134112

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145901

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151891

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155981

Predicted Effect

probably damaging
Transcript: ENSMUST00000169547
AA Change: C225R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126838
Gene: ENSMUSG00000038178
AA Change: C225R

Domain	Start	End	E-Value	Type
transmembrane domain	20	39	N/A	INTRINSIC
Pfam:MFS_1	58	393	2.4e-15	PFAM
transmembrane domain	426	448	N/A	INTRINSIC
transmembrane domain	453	475	N/A	INTRINSIC
transmembrane domain	482	504	N/A	INTRINSIC
transmembrane domain	514	536	N/A	INTRINSIC
low complexity region	538	550	N/A	INTRINSIC

Meta Mutation Damage Score

0.9730

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.1%
20x: 93.8%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the L-amino acid transporter-3 or SLC43 family of transporters. The encoded protein mediates sodium-, chloride-, and pH-independent transport of L-isomers of neutral amino acids, including leucine, phenylalanine, valine and methionine. This protein may contribute to the transfer of amino acids across the placental membrane to the fetus. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display fetal growth retardation, abnormal placental amino acid transport, slow postnatal weight gain, malnutrition and postnatal lethality, likely as a result of impaired intestinal amino acid absorption. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Targeted, knock-out(1) Gene trapped(7)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	A	G	7: 29,579,101		noncoding transcript	Het
Abr	T	A	11: 76,472,502	Q163L	probably benign	Het
AI314180	A	G	4: 58,832,729	L877S	probably damaging	Het
Ankrd11	C	A	8: 122,889,742	C2457F	probably damaging	Het
Anks3	G	C	16: 4,947,749	T163S	probably benign	Het
Cacna1d	G	A	14: 30,111,095	P908S	probably damaging	Het
Ccdc146	C	A	5: 21,316,904	R374L	possibly damaging	Het
Cdc45	G	T	16: 18,794,774	A348E	probably damaging	Het
Cfap46	A	G	7: 139,676,035	C300R	probably damaging	Het
Coq2	T	C	5: 100,663,685	N146S	probably benign	Het
Dalrd3	T	C	9: 108,572,215	V120A	possibly damaging	Het
Dcp2	T	A	18: 44,405,374		probably benign	Het
Ddx39	A	G	8: 83,720,622	K137R	possibly damaging	Het
Diaph3	A	G	14: 87,037,454		probably null	Het
Dmbt1	G	T	7: 131,119,496	R1668L	possibly damaging	Het
Dnah7a	T	G	1: 53,521,086		probably benign	Het
Dpp7	A	G	2: 25,356,095	Y49H	possibly damaging	Het
Drd5	A	G	5: 38,320,614	S317G	probably benign	Het
Ecsit	C	T	9: 22,076,288	V152I	probably benign	Het
Emc1	T	A	4: 139,375,163	M923K	possibly damaging	Het
Fam102a	G	A	2: 32,558,053	R58Q	possibly damaging	Het
Fcrl6	A	T	1: 172,598,753	L159Q	probably benign	Het
Frrs1	T	C	3: 116,885,297		probably benign	Het
Hspd1	A	G	1: 55,082,046		probably benign	Het
Impg2	T	A	16: 56,258,048	S458T	probably damaging	Het
Klf17	T	C	4: 117,760,392	Y256C	probably damaging	Het
Lnx2	A	G	5: 147,029,353	F319L	probably damaging	Het
Mafg	G	T	11: 120,629,604	R57S	probably damaging	Het
Med13l	T	A	5: 118,742,655	W1271R	probably damaging	Het
Mrgprb1	A	G	7: 48,447,214	S24P	probably benign	Het
Mtrf1l	T	C	10: 5,813,384	E315G	probably damaging	Het
Naip1	T	C	13: 100,411,001	E1239G	probably damaging	Het
Ncaph2	T	C	15: 89,369,664	S320P	probably damaging	Het
Nek11	A	G	9: 105,218,539		probably benign	Het
Nlrp2	A	T	7: 5,322,334		probably benign	Het
Odf3	C	A	7: 140,850,221		probably benign	Het
Rbm26	A	C	14: 105,152,540	V216G	possibly damaging	Het
Rnf115	A	G	3: 96,785,022	D178G	probably damaging	Het
Rtel1	C	T	2: 181,350,656	Q424*	probably null	Het
Rwdd4a	A	G	8: 47,537,365		probably benign	Het
Ryr3	T	C	2: 112,869,075	D890G	probably damaging	Het
Scarb1	C	A	5: 125,281,100		probably null	Het
Serpina10	A	G	12: 103,626,897		probably benign	Het
Slc12a5	T	A	2: 164,986,663	W508R	probably damaging	Het
Slc6a9	T	C	4: 117,864,859	F440L	probably damaging	Het
Stac3	G	A	10: 127,508,148	R305H	probably damaging	Het
Stk32b	A	G	5: 37,459,596		probably benign	Het
Syna	A	T	5: 134,559,543	L184H	probably damaging	Het
Tmprss7	T	C	16: 45,673,939	N401S	probably damaging	Het
Yeats2	T	A	16: 20,193,724	Y557*	probably null	Het
Zcchc11	T	G	4: 108,527,004	S1089R	probably damaging	Het
Zfp352	T	C	4: 90,224,285	S221P	probably damaging	Het
Zfp575	A	G	7: 24,586,087	V43A	probably benign	Het
Zfp775	A	G	6: 48,620,772	T527A	probably benign	Het

Other mutations in Slc43a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01790:Slc43a2	APN	11	75545751	splice site	probably null
IGL03009:Slc43a2	APN	11	75572376	missense	probably benign
IGL03145:Slc43a2	APN	11	75568437	missense	probably benign	0.27
1mM(1):Slc43a2	UTSW	11	75566996	missense	possibly damaging	0.80
R0051:Slc43a2	UTSW	11	75562850	missense	probably damaging	1.00
R0133:Slc43a2	UTSW	11	75563577	missense	probably benign	0.22
R0443:Slc43a2	UTSW	11	75544667	splice site	probably benign
R0841:Slc43a2	UTSW	11	75566989	nonsense	probably null
R1145:Slc43a2	UTSW	11	75566989	nonsense	probably null
R1145:Slc43a2	UTSW	11	75566989	nonsense	probably null
R1215:Slc43a2	UTSW	11	75562862	missense	probably damaging	1.00
R1499:Slc43a2	UTSW	11	75562907	critical splice donor site	probably null
R1943:Slc43a2	UTSW	11	75545741	splice site	probably null
R2438:Slc43a2	UTSW	11	75563131	missense	possibly damaging	0.90
R2512:Slc43a2	UTSW	11	75570577	missense	probably damaging	1.00
R3726:Slc43a2	UTSW	11	75543154	splice site	probably benign
R3804:Slc43a2	UTSW	11	75563598	missense	probably benign	0.01
R4830:Slc43a2	UTSW	11	75543293	missense	probably damaging	1.00
R5650:Slc43a2	UTSW	11	75545807	missense	probably damaging	1.00
R6042:Slc43a2	UTSW	11	75570607	missense	probably damaging	0.98
R6171:Slc43a2	UTSW	11	75563050	missense	probably damaging	1.00
R6196:Slc43a2	UTSW	11	75568380	nonsense	probably null
R6264:Slc43a2	UTSW	11	75567074	missense	possibly damaging	0.90
R6597:Slc43a2	UTSW	11	75571855	missense	probably damaging	1.00
R7681:Slc43a2	UTSW	11	75563673	missense	probably benign	0.02
R7787:Slc43a2	UTSW	11	75563074	missense	probably damaging	1.00
R8174:Slc43a2	UTSW	11	75543367	critical splice donor site	probably null
X0060:Slc43a2	UTSW	11	75532665	missense	probably null	0.91

Predicted Primers

PCR Primer
(F):5'- AGCCAGGACTGTTTACTGTGACCC -3'
(R):5'- GAACTTGATCTTCACCCTAGCAGCC -3'

Sequencing Primer
(F):5'- TTTACTGTGACCCAGCAAGG -3'
(R):5'- CCCTAGCAGCCATAGGAAGG -3'

Posted On

2013-08-06