Incidental Mutation 'R0051:Slc43a2'
ID64302
Institutional Source Beutler Lab
Gene Symbol Slc43a2
Ensembl Gene ENSMUSG00000038178
Gene Namesolute carrier family 43, member 2
Synonyms7630402D21Rik
MMRRC Submission 038345-MU
Accession Numbers

Genbank: NM_001199283.1, NM_001199284.1, NM_173388.2; Ensembl: ENSMUST00000042561

Is this an essential gene? Possibly essential (E-score: 0.645) question?
Stock #R0051 (G1)
Quality Score144
Status Validated
Chromosome11
Chromosomal Location75531694-75577575 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75562850 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 225 (C225R)
Ref Sequence ENSEMBL: ENSMUSP00000126838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042561] [ENSMUST00000108433] [ENSMUST00000169547]
Predicted Effect probably damaging
Transcript: ENSMUST00000042561
AA Change: C225R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046074
Gene: ENSMUSG00000038178
AA Change: C225R

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:MFS_1 58 393 2.9e-15 PFAM
transmembrane domain 426 448 N/A INTRINSIC
transmembrane domain 453 475 N/A INTRINSIC
transmembrane domain 482 504 N/A INTRINSIC
transmembrane domain 514 536 N/A INTRINSIC
low complexity region 538 550 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108433
AA Change: C225R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104071
Gene: ENSMUSG00000038178
AA Change: C225R

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:MFS_1 58 393 2.4e-15 PFAM
transmembrane domain 426 448 N/A INTRINSIC
transmembrane domain 453 475 N/A INTRINSIC
transmembrane domain 482 504 N/A INTRINSIC
transmembrane domain 514 536 N/A INTRINSIC
low complexity region 538 550 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155981
Predicted Effect probably damaging
Transcript: ENSMUST00000169547
AA Change: C225R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126838
Gene: ENSMUSG00000038178
AA Change: C225R

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:MFS_1 58 393 2.4e-15 PFAM
transmembrane domain 426 448 N/A INTRINSIC
transmembrane domain 453 475 N/A INTRINSIC
transmembrane domain 482 504 N/A INTRINSIC
transmembrane domain 514 536 N/A INTRINSIC
low complexity region 538 550 N/A INTRINSIC
Meta Mutation Damage Score 0.9730 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the L-amino acid transporter-3 or SLC43 family of transporters. The encoded protein mediates sodium-, chloride-, and pH-independent transport of L-isomers of neutral amino acids, including leucine, phenylalanine, valine and methionine. This protein may contribute to the transfer of amino acids across the placental membrane to the fetus. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display fetal growth retardation, abnormal placental amino acid transport, slow postnatal weight gain, malnutrition and postnatal lethality, likely as a result of impaired intestinal amino acid absorption. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(1) Gene trapped(7)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,579,101 noncoding transcript Het
Abr T A 11: 76,472,502 Q163L probably benign Het
AI314180 A G 4: 58,832,729 L877S probably damaging Het
Ankrd11 C A 8: 122,889,742 C2457F probably damaging Het
Anks3 G C 16: 4,947,749 T163S probably benign Het
Cacna1d G A 14: 30,111,095 P908S probably damaging Het
Ccdc146 C A 5: 21,316,904 R374L possibly damaging Het
Cdc45 G T 16: 18,794,774 A348E probably damaging Het
Cfap46 A G 7: 139,676,035 C300R probably damaging Het
Coq2 T C 5: 100,663,685 N146S probably benign Het
Dalrd3 T C 9: 108,572,215 V120A possibly damaging Het
Dcp2 T A 18: 44,405,374 probably benign Het
Ddx39 A G 8: 83,720,622 K137R possibly damaging Het
Diaph3 A G 14: 87,037,454 probably null Het
Dmbt1 G T 7: 131,119,496 R1668L possibly damaging Het
Dnah7a T G 1: 53,521,086 probably benign Het
Dpp7 A G 2: 25,356,095 Y49H possibly damaging Het
Drd5 A G 5: 38,320,614 S317G probably benign Het
Ecsit C T 9: 22,076,288 V152I probably benign Het
Emc1 T A 4: 139,375,163 M923K possibly damaging Het
Fam102a G A 2: 32,558,053 R58Q possibly damaging Het
Fcrl6 A T 1: 172,598,753 L159Q probably benign Het
Frrs1 T C 3: 116,885,297 probably benign Het
Hspd1 A G 1: 55,082,046 probably benign Het
Impg2 T A 16: 56,258,048 S458T probably damaging Het
Klf17 T C 4: 117,760,392 Y256C probably damaging Het
Lnx2 A G 5: 147,029,353 F319L probably damaging Het
Mafg G T 11: 120,629,604 R57S probably damaging Het
Med13l T A 5: 118,742,655 W1271R probably damaging Het
Mrgprb1 A G 7: 48,447,214 S24P probably benign Het
Mtrf1l T C 10: 5,813,384 E315G probably damaging Het
Naip1 T C 13: 100,411,001 E1239G probably damaging Het
Ncaph2 T C 15: 89,369,664 S320P probably damaging Het
Nek11 A G 9: 105,218,539 probably benign Het
Nlrp2 A T 7: 5,322,334 probably benign Het
Odf3 C A 7: 140,850,221 probably benign Het
Rbm26 A C 14: 105,152,540 V216G possibly damaging Het
Rnf115 A G 3: 96,785,022 D178G probably damaging Het
Rtel1 C T 2: 181,350,656 Q424* probably null Het
Rwdd4a A G 8: 47,537,365 probably benign Het
Ryr3 T C 2: 112,869,075 D890G probably damaging Het
Scarb1 C A 5: 125,281,100 probably null Het
Serpina10 A G 12: 103,626,897 probably benign Het
Slc12a5 T A 2: 164,986,663 W508R probably damaging Het
Slc6a9 T C 4: 117,864,859 F440L probably damaging Het
Stac3 G A 10: 127,508,148 R305H probably damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Syna A T 5: 134,559,543 L184H probably damaging Het
Tmprss7 T C 16: 45,673,939 N401S probably damaging Het
Yeats2 T A 16: 20,193,724 Y557* probably null Het
Zcchc11 T G 4: 108,527,004 S1089R probably damaging Het
Zfp352 T C 4: 90,224,285 S221P probably damaging Het
Zfp575 A G 7: 24,586,087 V43A probably benign Het
Zfp775 A G 6: 48,620,772 T527A probably benign Het
Other mutations in Slc43a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01790:Slc43a2 APN 11 75545751 splice site probably null
IGL03009:Slc43a2 APN 11 75572376 missense probably benign
IGL03145:Slc43a2 APN 11 75568437 missense probably benign 0.27
1mM(1):Slc43a2 UTSW 11 75566996 missense possibly damaging 0.80
R0051:Slc43a2 UTSW 11 75562850 missense probably damaging 1.00
R0133:Slc43a2 UTSW 11 75563577 missense probably benign 0.22
R0443:Slc43a2 UTSW 11 75544667 splice site probably benign
R0841:Slc43a2 UTSW 11 75566989 nonsense probably null
R1145:Slc43a2 UTSW 11 75566989 nonsense probably null
R1145:Slc43a2 UTSW 11 75566989 nonsense probably null
R1215:Slc43a2 UTSW 11 75562862 missense probably damaging 1.00
R1499:Slc43a2 UTSW 11 75562907 critical splice donor site probably null
R1943:Slc43a2 UTSW 11 75545741 splice site probably null
R2438:Slc43a2 UTSW 11 75563131 missense possibly damaging 0.90
R2512:Slc43a2 UTSW 11 75570577 missense probably damaging 1.00
R3726:Slc43a2 UTSW 11 75543154 splice site probably benign
R3804:Slc43a2 UTSW 11 75563598 missense probably benign 0.01
R4830:Slc43a2 UTSW 11 75543293 missense probably damaging 1.00
R5650:Slc43a2 UTSW 11 75545807 missense probably damaging 1.00
R6042:Slc43a2 UTSW 11 75570607 missense probably damaging 0.98
R6171:Slc43a2 UTSW 11 75563050 missense probably damaging 1.00
R6196:Slc43a2 UTSW 11 75568380 nonsense probably null
R6264:Slc43a2 UTSW 11 75567074 missense possibly damaging 0.90
R6597:Slc43a2 UTSW 11 75571855 missense probably damaging 1.00
R7681:Slc43a2 UTSW 11 75563673 missense probably benign 0.02
R7787:Slc43a2 UTSW 11 75563074 missense probably damaging 1.00
R8174:Slc43a2 UTSW 11 75543367 critical splice donor site probably null
X0060:Slc43a2 UTSW 11 75532665 missense probably null 0.91
Predicted Primers PCR Primer
(F):5'- AGCCAGGACTGTTTACTGTGACCC -3'
(R):5'- GAACTTGATCTTCACCCTAGCAGCC -3'

Sequencing Primer
(F):5'- TTTACTGTGACCCAGCAAGG -3'
(R):5'- CCCTAGCAGCCATAGGAAGG -3'
Posted On2013-08-06