Mutagenetix > Incidental Mutation

Incidental Mutation 'R0051:Diaph3'

64306

Institutional Source

Beutler Lab

Gene Symbol

Diaph3

Ensembl Gene

ENSMUSG00000022021

Gene Name

diaphanous related formin 3

Synonyms

4930417P13Rik, Diap3, mDia2, p134MDia2, Drf3

MMRRC Submission

038345-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0051 (G1)

Quality Score

137

Status

Validated

Chromosome

Chromosomal Location

86655367-87141235 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 87037454 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000129420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022599] [ENSMUST00000168889] [ENSMUST00000228000]

AlphaFold

Q9Z207

Predicted Effect

probably null
Transcript: ENSMUST00000022599

SMART Domains

Protein: ENSMUSP00000022599
Gene: ENSMUSG00000022021

Domain	Start	End	E-Value	Type
low complexity region	76	86	N/A	INTRINSIC
Drf_GBD	93	276	7.94e-61	SMART
Drf_FH3	281	467	5.74e-67	SMART
coiled coil region	485	533	N/A	INTRINSIC
SCOP:d1jvr__	545	589	1e-3	SMART
FH2	615	1056	3.88e-180	SMART
Blast:FH2	1087	1160	2e-27	BLAST
low complexity region	1163	1171	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000168889

SMART Domains

Protein: ENSMUSP00000129420
Gene: ENSMUSG00000022021

Domain	Start	End	E-Value	Type
low complexity region	76	86	N/A	INTRINSIC
Drf_GBD	93	276	7.94e-61	SMART
Drf_FH3	281	467	5.74e-67	SMART
coiled coil region	485	533	N/A	INTRINSIC
SCOP:d1jvr__	545	589	1e-3	SMART
FH2	615	1056	3.2e-181	SMART
Blast:FH2	1087	1160	2e-27	BLAST
low complexity region	1163	1171	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226492

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227666

Predicted Effect

probably benign
Transcript: ENSMUST00000228000

Meta Mutation Damage Score

0.9495

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.1%
20x: 93.8%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in this gene are associated with autosomal dominant auditory neuropathy 1. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for disruption of this gene display embryonic mortality and abnormal cytokinesis of RBC. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	A	G	7: 29,579,101		noncoding transcript	Het
Abr	T	A	11: 76,472,502	Q163L	probably benign	Het
AI314180	A	G	4: 58,832,729	L877S	probably damaging	Het
Ankrd11	C	A	8: 122,889,742	C2457F	probably damaging	Het
Anks3	G	C	16: 4,947,749	T163S	probably benign	Het
Cacna1d	G	A	14: 30,111,095	P908S	probably damaging	Het
Ccdc146	C	A	5: 21,316,904	R374L	possibly damaging	Het
Cdc45	G	T	16: 18,794,774	A348E	probably damaging	Het
Cfap46	A	G	7: 139,676,035	C300R	probably damaging	Het
Coq2	T	C	5: 100,663,685	N146S	probably benign	Het
Dalrd3	T	C	9: 108,572,215	V120A	possibly damaging	Het
Dcp2	T	A	18: 44,405,374		probably benign	Het
Ddx39	A	G	8: 83,720,622	K137R	possibly damaging	Het
Dmbt1	G	T	7: 131,119,496	R1668L	possibly damaging	Het
Dnah7a	T	G	1: 53,521,086		probably benign	Het
Dpp7	A	G	2: 25,356,095	Y49H	possibly damaging	Het
Drd5	A	G	5: 38,320,614	S317G	probably benign	Het
Ecsit	C	T	9: 22,076,288	V152I	probably benign	Het
Emc1	T	A	4: 139,375,163	M923K	possibly damaging	Het
Fam102a	G	A	2: 32,558,053	R58Q	possibly damaging	Het
Fcrl6	A	T	1: 172,598,753	L159Q	probably benign	Het
Frrs1	T	C	3: 116,885,297		probably benign	Het
Hspd1	A	G	1: 55,082,046		probably benign	Het
Impg2	T	A	16: 56,258,048	S458T	probably damaging	Het
Klf17	T	C	4: 117,760,392	Y256C	probably damaging	Het
Lnx2	A	G	5: 147,029,353	F319L	probably damaging	Het
Mafg	G	T	11: 120,629,604	R57S	probably damaging	Het
Med13l	T	A	5: 118,742,655	W1271R	probably damaging	Het
Mrgprb1	A	G	7: 48,447,214	S24P	probably benign	Het
Mtrf1l	T	C	10: 5,813,384	E315G	probably damaging	Het
Naip1	T	C	13: 100,411,001	E1239G	probably damaging	Het
Ncaph2	T	C	15: 89,369,664	S320P	probably damaging	Het
Nek11	A	G	9: 105,218,539		probably benign	Het
Nlrp2	A	T	7: 5,322,334		probably benign	Het
Odf3	C	A	7: 140,850,221		probably benign	Het
Rbm26	A	C	14: 105,152,540	V216G	possibly damaging	Het
Rnf115	A	G	3: 96,785,022	D178G	probably damaging	Het
Rtel1	C	T	2: 181,350,656	Q424*	probably null	Het
Rwdd4a	A	G	8: 47,537,365		probably benign	Het
Ryr3	T	C	2: 112,869,075	D890G	probably damaging	Het
Scarb1	C	A	5: 125,281,100		probably null	Het
Serpina10	A	G	12: 103,626,897		probably benign	Het
Slc12a5	T	A	2: 164,986,663	W508R	probably damaging	Het
Slc43a2	T	C	11: 75,562,850	C225R	probably damaging	Het
Slc6a9	T	C	4: 117,864,859	F440L	probably damaging	Het
Stac3	G	A	10: 127,508,148	R305H	probably damaging	Het
Stk32b	A	G	5: 37,459,596		probably benign	Het
Syna	A	T	5: 134,559,543	L184H	probably damaging	Het
Tmprss7	T	C	16: 45,673,939	N401S	probably damaging	Het
Yeats2	T	A	16: 20,193,724	Y557*	probably null	Het
Zcchc11	T	G	4: 108,527,004	S1089R	probably damaging	Het
Zfp352	T	C	4: 90,224,285	S221P	probably damaging	Het
Zfp575	A	G	7: 24,586,087	V43A	probably benign	Het
Zfp775	A	G	6: 48,620,772	T527A	probably benign	Het

Other mutations in Diaph3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00566:Diaph3	APN	14	87002871	missense	probably benign
IGL00809:Diaph3	APN	14	87000027	missense	probably damaging	0.98
IGL01419:Diaph3	APN	14	86965553	nonsense	probably null
IGL01577:Diaph3	APN	14	86906031	missense	probably damaging	0.99
IGL01718:Diaph3	APN	14	86656338	missense	unknown
IGL01736:Diaph3	APN	14	86918846	missense	probably benign	0.01
IGL01893:Diaph3	APN	14	86918852	missense	possibly damaging	0.71
IGL02316:Diaph3	APN	14	86986115	missense	possibly damaging	0.88
IGL02527:Diaph3	APN	14	86810359	missense	possibly damaging	0.47
IGL02586:Diaph3	APN	14	86986076	nonsense	probably null
IGL02749:Diaph3	APN	14	86918825	missense	probably damaging	0.99
IGL02892:Diaph3	APN	14	86866630	nonsense	probably null
IGL03069:Diaph3	APN	14	86772119	missense	probably damaging	1.00
IGL03191:Diaph3	APN	14	87073302	missense	possibly damaging	0.75
BB008:Diaph3	UTSW	14	87115020	missense	possibly damaging	0.70
BB018:Diaph3	UTSW	14	87115020	missense	possibly damaging	0.70
R0007:Diaph3	UTSW	14	86866620	missense	possibly damaging	0.86
R0007:Diaph3	UTSW	14	86866620	missense	possibly damaging	0.86
R0011:Diaph3	UTSW	14	86866408	missense	probably damaging	1.00
R0051:Diaph3	UTSW	14	87037454	critical splice donor site	probably null
R0285:Diaph3	UTSW	14	87115024	missense	possibly damaging	0.86
R0359:Diaph3	UTSW	14	86969502	missense	probably benign	0.26
R0505:Diaph3	UTSW	14	87090964	splice site	probably benign
R0551:Diaph3	UTSW	14	86910100	missense	probably benign	0.45
R1295:Diaph3	UTSW	14	87007399	missense	probably damaging	1.00
R1539:Diaph3	UTSW	14	86656480	missense	probably damaging	1.00
R1602:Diaph3	UTSW	14	87091158	splice site	probably benign
R1725:Diaph3	UTSW	14	86966323	critical splice donor site	probably null
R1745:Diaph3	UTSW	14	86966560	missense	probably damaging	0.96
R1747:Diaph3	UTSW	14	87073337	missense	probably damaging	0.98
R1772:Diaph3	UTSW	14	86965549	missense	probably damaging	1.00
R1914:Diaph3	UTSW	14	86656485	missense	probably damaging	0.98
R1942:Diaph3	UTSW	14	87141120	utr 5 prime	probably benign
R1999:Diaph3	UTSW	14	86984866	missense	possibly damaging	0.53
R2291:Diaph3	UTSW	14	86966446	missense	probably damaging	1.00
R2999:Diaph3	UTSW	14	86772094	missense	probably damaging	0.99
R3158:Diaph3	UTSW	14	86656456	missense	possibly damaging	0.84
R3612:Diaph3	UTSW	14	87037457	missense	probably null	0.89
R4170:Diaph3	UTSW	14	86985707	missense	probably damaging	1.00
R4594:Diaph3	UTSW	14	86986037	missense	probably damaging	0.99
R4912:Diaph3	UTSW	14	87007199	missense	probably damaging	1.00
R4930:Diaph3	UTSW	14	87141166	start gained	probably benign
R5063:Diaph3	UTSW	14	86984870	missense	probably damaging	1.00
R5093:Diaph3	UTSW	14	86984800	missense	probably damaging	1.00
R5267:Diaph3	UTSW	14	86656553	missense	probably benign	0.03
R5289:Diaph3	UTSW	14	86981678	missense	probably damaging	1.00
R5549:Diaph3	UTSW	14	86978670	missense	probably benign	0.14
R5936:Diaph3	UTSW	14	86772116	missense	possibly damaging	0.53
R5966:Diaph3	UTSW	14	86984825	missense	probably damaging	1.00
R6236:Diaph3	UTSW	14	87037568	nonsense	probably null
R6323:Diaph3	UTSW	14	86966453	missense	probably benign	0.03
R6331:Diaph3	UTSW	14	86866540	missense	probably damaging	1.00
R6362:Diaph3	UTSW	14	86772130	missense	probably damaging	1.00
R6398:Diaph3	UTSW	14	86866486	missense	probably damaging	1.00
R6408:Diaph3	UTSW	14	86828994	missense	possibly damaging	0.68
R6469:Diaph3	UTSW	14	86656538	missense	possibly damaging	0.71
R6519:Diaph3	UTSW	14	86966335	missense	probably damaging	1.00
R7261:Diaph3	UTSW	14	86965457	missense	probably benign	0.04
R7283:Diaph3	UTSW	14	86866584	missense	probably damaging	1.00
R7782:Diaph3	UTSW	14	87037504	missense	probably benign	0.00
R7811:Diaph3	UTSW	14	86981624	missense	probably damaging	1.00
R7931:Diaph3	UTSW	14	87115020	missense	possibly damaging	0.70
R8012:Diaph3	UTSW	14	87037522	missense	probably benign
R8024:Diaph3	UTSW	14	86656399	missense	probably damaging	1.00
R8065:Diaph3	UTSW	14	87037495	missense	probably damaging	1.00
R8271:Diaph3	UTSW	14	86866513	missense	probably damaging	1.00
R8345:Diaph3	UTSW	14	86829093	nonsense	probably null
R8494:Diaph3	UTSW	14	87037522	missense	probably benign
R8670:Diaph3	UTSW	14	86656399	missense	probably benign	0.05
R9225:Diaph3	UTSW	14	87007324	critical splice donor site	probably null
R9304:Diaph3	UTSW	14	87091012	missense	possibly damaging	0.94
R9331:Diaph3	UTSW	14	87141025	nonsense	probably null
R9532:Diaph3	UTSW	14	86656480	missense	probably damaging	1.00
Z1176:Diaph3	UTSW	14	86656432	missense	probably benign	0.09
Z1177:Diaph3	UTSW	14	87002814	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTATGCCAGGCTGTGTCAGATAA -3'
(R):5'- gttggtcagagGATGTTTTGAGATTTGC -3'

Sequencing Primer
(F):5'- tccccaccctcaccctc -3'
(R):5'- GCGTTCCAATAGTCAAATATGCC -3'

Posted On

2013-08-06