Incidental Mutation 'BB019:Igf1r'
ID 643061
Institutional Source Beutler Lab
Gene Symbol Igf1r
Ensembl Gene ENSMUSG00000005533
Gene Name insulin-like growth factor I receptor
Synonyms line 186, A330103N21Rik, CD221, hyft, IGF-1R
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # BB019
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 67952827-68233668 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 68212054 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1121 (I1121F)
Ref Sequence ENSEMBL: ENSMUSP00000005671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005671]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000005671
AA Change: I1121F

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: I1121F

DomainStartEndE-ValueType
Pfam:Recep_L_domain 51 161 1.6e-29 PFAM
FU 227 270 2.98e-12 SMART
Pfam:Recep_L_domain 353 467 3.8e-32 PFAM
FN3 490 593 4.67e-2 SMART
FN3 612 815 1.95e-4 SMART
FN3 833 915 7.4e-5 SMART
low complexity region 937 954 N/A INTRINSIC
TyrKc 1000 1268 8.51e-141 SMART
low complexity region 1285 1303 N/A INTRINSIC
low complexity region 1306 1319 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,573,180 R666G unknown Het
Adam21 T A 12: 81,560,164 N275Y probably damaging Het
Arhgap24 A T 5: 102,845,969 probably benign Het
Arhgef1 C T 7: 24,919,710 L459F probably damaging Het
Bbx A T 16: 50,210,443 probably null Het
Blk C T 14: 63,373,559 G445S possibly damaging Het
Brca1 T C 11: 101,540,017 E33G possibly damaging Het
Cacna1s T G 1: 136,084,359 L513R probably damaging Het
Cnn3 T A 3: 121,451,429 M98K probably benign Het
Cttnbp2 T A 6: 18,427,533 L716F probably damaging Het
Dlgap1 A T 17: 70,516,238 R73W probably damaging Het
Dnajc4 A G 19: 6,988,270 L182P probably damaging Het
Dock2 T C 11: 34,267,998 M1191V probably benign Het
Fam13a C T 6: 58,983,888 probably null Het
Fbn2 C T 18: 58,020,483 G2569E possibly damaging Het
Fes T C 7: 80,379,872 I623V probably damaging Het
Fyco1 A C 9: 123,828,990 L707R possibly damaging Het
Gadd45b T A 10: 80,930,335 V7E possibly damaging Het
Gm12169 C A 11: 46,535,539 P158T probably benign Het
Gm19410 T A 8: 35,795,599 C897S probably damaging Het
Hk1 A G 10: 62,315,520 L31P probably damaging Het
Hoxa4 T G 6: 52,190,417 K261N probably damaging Het
Hrh4 T A 18: 13,015,812 L77* probably null Het
Igkv16-104 A T 6: 68,425,794 I24L probably benign Het
Itk A T 11: 46,340,692 W346R probably benign Het
Kdm2a A G 19: 4,319,156 S1144P probably damaging Het
Krt86 A T 15: 101,476,592 S289C probably damaging Het
Lonrf1 T C 8: 36,222,916 I663V probably benign Het
Lrp2 T G 2: 69,426,027 I4590L probably benign Het
Lrrc8d C T 5: 105,813,025 R434C probably damaging Het
Maneal T C 4: 124,861,845 Y108C probably damaging Het
Myh8 G A 11: 67,294,604 V894I probably benign Het
Ncam2 T G 16: 81,615,820 L732R probably damaging Het
Nsun4 A T 4: 116,044,800 D156E probably damaging Het
Olfr111 T C 17: 37,530,184 I69T probably benign Het
Olfr136 A T 17: 38,335,255 I33L probably benign Het
Olfr1459 A T 19: 13,145,981 M226K probably benign Het
Olfr382 A C 11: 73,517,157 L14R probably damaging Het
Olfr419 T C 1: 174,250,694 I78V probably benign Het
Olfr798 C A 10: 129,625,225 V279F probably damaging Het
P2rx7 G A 5: 122,644,182 V37I probably benign Het
Pcdh15 A G 10: 74,645,527 R235G probably benign Het
Pcdhga1 T C 18: 37,663,460 S506P probably damaging Het
Pira2 A T 7: 3,842,436 probably null Het
Plch1 A G 3: 63,701,981 V935A probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Prpf8 A G 11: 75,492,597 D607G possibly damaging Het
Ptdss1 T C 13: 66,966,432 W215R probably damaging Het
Ptpn9 C A 9: 57,036,616 P258Q possibly damaging Het
Rfpl4b A G 10: 38,821,350 V85A possibly damaging Het
Sacs C A 14: 61,204,878 Q1458K probably damaging Het
Scfd2 A T 5: 74,531,550 S24T probably benign Het
Siae A G 9: 37,633,684 D325G probably benign Het
Slc22a23 C A 13: 34,182,977 A683S probably damaging Het
Slc44a3 A T 3: 121,512,360 I244N possibly damaging Het
Srrm2 T A 17: 23,818,527 S1382T probably benign Het
Tfap2c A G 2: 172,551,786 Y207C probably damaging Het
Tnc T C 4: 64,008,620 I890V probably benign Het
Trim30a A T 7: 104,429,338 I177N probably benign Het
Tshz2 T A 2: 169,886,331 M949K possibly damaging Het
Ttn T G 2: 76,725,186 T30492P probably damaging Het
Ubb C T 11: 62,552,785 Q214* probably null Het
Ulk2 A G 11: 61,808,090 S423P probably benign Het
Vmn1r237 C A 17: 21,314,463 D149E probably benign Het
Zbtb24 A G 10: 41,451,508 D130G probably benign Het
Zfp689 C A 7: 127,444,351 G369V probably damaging Het
Zg16 A G 7: 127,050,405 F128S probably damaging Het
Zmym1 T G 4: 127,050,785 N203T possibly damaging Het
Other mutations in Igf1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Igf1r APN 7 68190023 missense probably benign
IGL00837:Igf1r APN 7 68201352 splice site probably benign
IGL01515:Igf1r APN 7 68207452 missense probably damaging 1.00
IGL01572:Igf1r APN 7 68193441 missense probably benign 0.01
IGL02100:Igf1r APN 7 68189958 missense probably benign 0.05
IGL02506:Igf1r APN 7 68193396 missense probably benign
IGL02672:Igf1r APN 7 68190033 missense probably benign 0.05
IGL02701:Igf1r APN 7 68201249 missense possibly damaging 0.93
IGL02742:Igf1r APN 7 68189991 missense possibly damaging 0.94
IGL03073:Igf1r APN 7 68215043 missense probably damaging 1.00
IGL03257:Igf1r APN 7 68214940 missense probably damaging 1.00
Frufru UTSW 7 68004163 missense probably damaging 1.00
Hungarian UTSW 7 68214997 missense probably damaging 1.00
Mimi UTSW 7 68195026 missense possibly damaging 0.67
Piroshka UTSW 7 68207336 nonsense probably null
Romanian UTSW 7 68004137 missense possibly damaging 0.94
Sublime UTSW 7 68004179 missense probably damaging 1.00
Toy UTSW 7 68003972 missense probably damaging 1.00
BB009:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
FR4548:Igf1r UTSW 7 68226186 small insertion probably benign
FR4737:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226186 small insertion probably benign
PIT4445001:Igf1r UTSW 7 68207463 missense probably damaging 1.00
R0003:Igf1r UTSW 7 68165242 missense probably damaging 1.00
R0184:Igf1r UTSW 7 68226193 missense possibly damaging 0.84
R0538:Igf1r UTSW 7 68207826 missense probably damaging 1.00
R0632:Igf1r UTSW 7 68165155 missense probably damaging 1.00
R0727:Igf1r UTSW 7 68212158 critical splice donor site probably null
R0750:Igf1r UTSW 7 68212091 missense probably damaging 0.99
R1104:Igf1r UTSW 7 68195026 missense possibly damaging 0.67
R1169:Igf1r UTSW 7 68165127 missense probably benign 0.00
R1348:Igf1r UTSW 7 68218468 missense probably damaging 1.00
R1471:Igf1r UTSW 7 68003837 missense probably damaging 0.98
R1580:Igf1r UTSW 7 68207869 missense probably benign
R1745:Igf1r UTSW 7 68169913 missense probably damaging 1.00
R1772:Igf1r UTSW 7 68195074 missense probably benign 0.03
R1789:Igf1r UTSW 7 68214933 nonsense probably null
R1823:Igf1r UTSW 7 68194981 missense possibly damaging 0.77
R1902:Igf1r UTSW 7 68201249 missense possibly damaging 0.93
R1962:Igf1r UTSW 7 68207275 missense probably damaging 0.99
R2179:Igf1r UTSW 7 68003950 missense probably damaging 0.99
R2215:Igf1r UTSW 7 68165234 missense probably benign
R2221:Igf1r UTSW 7 68201962 missense probably damaging 1.00
R2233:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2234:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2235:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R3023:Igf1r UTSW 7 68183399 missense probably benign 0.00
R4044:Igf1r UTSW 7 68190062 missense possibly damaging 0.83
R4226:Igf1r UTSW 7 68195078 nonsense probably null
R4387:Igf1r UTSW 7 68170009 missense probably benign
R4388:Igf1r UTSW 7 68170009 missense probably benign
R4728:Igf1r UTSW 7 68189624 missense probably damaging 1.00
R4781:Igf1r UTSW 7 68165199 missense possibly damaging 0.75
R5254:Igf1r UTSW 7 68207319 missense probably damaging 0.99
R5278:Igf1r UTSW 7 68193418 missense possibly damaging 0.78
R5510:Igf1r UTSW 7 68193359 missense probably benign 0.19
R5522:Igf1r UTSW 7 68183510 missense probably damaging 0.96
R5527:Igf1r UTSW 7 68207821 missense probably damaging 1.00
R5761:Igf1r UTSW 7 68207253 missense probably damaging 1.00
R5849:Igf1r UTSW 7 68190033 missense probably benign
R6189:Igf1r UTSW 7 68207336 nonsense probably null
R6262:Igf1r UTSW 7 68003972 missense probably damaging 1.00
R6285:Igf1r UTSW 7 68004137 missense possibly damaging 0.94
R6318:Igf1r UTSW 7 68165233 missense probably benign 0.02
R6365:Igf1r UTSW 7 68190050 missense probably benign 0.26
R6377:Igf1r UTSW 7 68201250 missense probably benign 0.00
R6831:Igf1r UTSW 7 68207319 missense possibly damaging 0.75
R6848:Igf1r UTSW 7 68004179 missense probably damaging 1.00
R6902:Igf1r UTSW 7 68004163 missense probably damaging 1.00
R7193:Igf1r UTSW 7 68187157 missense probably damaging 1.00
R7373:Igf1r UTSW 7 68195078 nonsense probably null
R7442:Igf1r UTSW 7 68173278 missense probably damaging 1.00
R7903:Igf1r UTSW 7 68184752 missense probably damaging 1.00
R7923:Igf1r UTSW 7 68190101 missense probably damaging 1.00
R7932:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
R8368:Igf1r UTSW 7 68187048 missense probably benign 0.03
R8458:Igf1r UTSW 7 68195629 missense probably benign
R8539:Igf1r UTSW 7 68003848 missense probably benign 0.06
R8704:Igf1r UTSW 7 68170054 splice site probably benign
R8746:Igf1r UTSW 7 68214997 missense probably damaging 1.00
R8829:Igf1r UTSW 7 68226021 missense probably damaging 1.00
R8832:Igf1r UTSW 7 68226021 missense probably damaging 1.00
R8859:Igf1r UTSW 7 68183463 missense possibly damaging 0.75
R9057:Igf1r UTSW 7 68183438 missense probably damaging 1.00
R9243:Igf1r UTSW 7 68212027 missense probably benign 0.11
R9342:Igf1r UTSW 7 68194998 missense probably benign 0.00
R9412:Igf1r UTSW 7 68207253 missense probably damaging 1.00
R9525:Igf1r UTSW 7 68214934 missense probably damaging 1.00
R9727:Igf1r UTSW 7 68207806 missense probably damaging 1.00
R9730:Igf1r UTSW 7 68189675 missense probably damaging 1.00
R9779:Igf1r UTSW 7 68004317 missense probably damaging 1.00
RF025:Igf1r UTSW 7 68226179 small insertion probably benign
RF032:Igf1r UTSW 7 68226179 small insertion probably benign
RF034:Igf1r UTSW 7 68226176 small insertion probably benign
RF037:Igf1r UTSW 7 68226176 small insertion probably benign
RF039:Igf1r UTSW 7 68226176 small insertion probably benign
RF044:Igf1r UTSW 7 68226179 small insertion probably benign
Z1186:Igf1r UTSW 7 68226168 small insertion probably benign
Z1186:Igf1r UTSW 7 68226169 small insertion probably benign
Z1186:Igf1r UTSW 7 68226174 small insertion probably benign
Z1186:Igf1r UTSW 7 68226180 small insertion probably benign
Z1186:Igf1r UTSW 7 68226182 small insertion probably benign
Z1191:Igf1r UTSW 7 68226169 small insertion probably benign
Z1191:Igf1r UTSW 7 68226170 small insertion probably benign
Z1191:Igf1r UTSW 7 68226173 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CTTAGCAAGTCCTGACTCCC -3'
(R):5'- TCTCTCCAGTGGCAGACTAATG -3'

Sequencing Primer
(F):5'- CAGGTGACCTGTGGTACTCAG -3'
(R):5'- TGACTGCAAAGTCCCCTCAG -3'
Posted On 2020-08-01