Incidental Mutation 'R0051:Ncaph2'
ID64308
Institutional Source Beutler Lab
Gene Symbol Ncaph2
Ensembl Gene ENSMUSG00000008690
Gene Namenon-SMC condensin II complex, subunit H2
SynonymsKleisin beta, D15Ertd785e, 2610524G04Rik, 0610010J20Rik
MMRRC Submission 038345-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R0051 (G1)
Quality Score108
Status Validated
Chromosome15
Chromosomal Location89355719-89372826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89369664 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 320 (S320P)
Ref Sequence ENSEMBL: ENSMUSP00000086095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023285] [ENSMUST00000036987] [ENSMUST00000074552] [ENSMUST00000088717] [ENSMUST00000145259] [ENSMUST00000167643] [ENSMUST00000228977]
Predicted Effect probably benign
Transcript: ENSMUST00000023285
SMART Domains Protein: ENSMUSP00000023285
Gene: ENSMUSG00000022615

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:Glycos_trans_3N 23 85 1.5e-20 PFAM
Pfam:Glycos_transf_3 95 326 3.1e-50 PFAM
PYNP_C 374 448 6.46e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036987
AA Change: S289P

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000036900
Gene: ENSMUSG00000008690
AA Change: S289P

DomainStartEndE-ValueType
Pfam:DUF1032 20 576 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000074552
AA Change: S320P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074139
Gene: ENSMUSG00000008690
AA Change: S320P

DomainStartEndE-ValueType
Pfam:DUF1032 51 607 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000088717
AA Change: S320P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000086095
Gene: ENSMUSG00000008690
AA Change: S320P

DomainStartEndE-ValueType
Pfam:CNDH2_N 11 123 1.2e-48 PFAM
Pfam:CNDH2_M 147 285 2.1e-20 PFAM
Pfam:CNDH2_C 308 598 1.9e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140665
Predicted Effect probably benign
Transcript: ENSMUST00000145259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151523
Predicted Effect probably benign
Transcript: ENSMUST00000167643
SMART Domains Protein: ENSMUSP00000131943
Gene: ENSMUSG00000091780

DomainStartEndE-ValueType
Pfam:SCO1-SenC 52 234 1.4e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228977
Meta Mutation Damage Score 0.1466 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: This gene encodes a component of the condensin-2 complex. The encoded protein may regulate the structure of mitotic chromosomes. Loss of function of this gene disrupts T-cell development. There are two pseudogenes for this gene on chromosome 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for an ENU-induced single point mutation display a specific defect in T cell development but are otherwise viable, fertile and overtly healthy with no apparent defects in B cell development. Homozygous null mice die before E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,579,101 noncoding transcript Het
Abr T A 11: 76,472,502 Q163L probably benign Het
AI314180 A G 4: 58,832,729 L877S probably damaging Het
Ankrd11 C A 8: 122,889,742 C2457F probably damaging Het
Anks3 G C 16: 4,947,749 T163S probably benign Het
Cacna1d G A 14: 30,111,095 P908S probably damaging Het
Ccdc146 C A 5: 21,316,904 R374L possibly damaging Het
Cdc45 G T 16: 18,794,774 A348E probably damaging Het
Cfap46 A G 7: 139,676,035 C300R probably damaging Het
Coq2 T C 5: 100,663,685 N146S probably benign Het
Dalrd3 T C 9: 108,572,215 V120A possibly damaging Het
Dcp2 T A 18: 44,405,374 probably benign Het
Ddx39 A G 8: 83,720,622 K137R possibly damaging Het
Diaph3 A G 14: 87,037,454 probably null Het
Dmbt1 G T 7: 131,119,496 R1668L possibly damaging Het
Dnah7a T G 1: 53,521,086 probably benign Het
Dpp7 A G 2: 25,356,095 Y49H possibly damaging Het
Drd5 A G 5: 38,320,614 S317G probably benign Het
Ecsit C T 9: 22,076,288 V152I probably benign Het
Emc1 T A 4: 139,375,163 M923K possibly damaging Het
Fam102a G A 2: 32,558,053 R58Q possibly damaging Het
Fcrl6 A T 1: 172,598,753 L159Q probably benign Het
Frrs1 T C 3: 116,885,297 probably benign Het
Hspd1 A G 1: 55,082,046 probably benign Het
Impg2 T A 16: 56,258,048 S458T probably damaging Het
Klf17 T C 4: 117,760,392 Y256C probably damaging Het
Lnx2 A G 5: 147,029,353 F319L probably damaging Het
Mafg G T 11: 120,629,604 R57S probably damaging Het
Med13l T A 5: 118,742,655 W1271R probably damaging Het
Mrgprb1 A G 7: 48,447,214 S24P probably benign Het
Mtrf1l T C 10: 5,813,384 E315G probably damaging Het
Naip1 T C 13: 100,411,001 E1239G probably damaging Het
Nek11 A G 9: 105,218,539 probably benign Het
Nlrp2 A T 7: 5,322,334 probably benign Het
Odf3 C A 7: 140,850,221 probably benign Het
Rbm26 A C 14: 105,152,540 V216G possibly damaging Het
Rnf115 A G 3: 96,785,022 D178G probably damaging Het
Rtel1 C T 2: 181,350,656 Q424* probably null Het
Rwdd4a A G 8: 47,537,365 probably benign Het
Ryr3 T C 2: 112,869,075 D890G probably damaging Het
Scarb1 C A 5: 125,281,100 probably null Het
Serpina10 A G 12: 103,626,897 probably benign Het
Slc12a5 T A 2: 164,986,663 W508R probably damaging Het
Slc43a2 T C 11: 75,562,850 C225R probably damaging Het
Slc6a9 T C 4: 117,864,859 F440L probably damaging Het
Stac3 G A 10: 127,508,148 R305H probably damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Syna A T 5: 134,559,543 L184H probably damaging Het
Tmprss7 T C 16: 45,673,939 N401S probably damaging Het
Yeats2 T A 16: 20,193,724 Y557* probably null Het
Zcchc11 T G 4: 108,527,004 S1089R probably damaging Het
Zfp352 T C 4: 90,224,285 S221P probably damaging Het
Zfp575 A G 7: 24,586,087 V43A probably benign Het
Zfp775 A G 6: 48,620,772 T527A probably benign Het
Other mutations in Ncaph2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00784:Ncaph2 APN 15 89370040 missense probably damaging 1.00
IGL01640:Ncaph2 APN 15 89363838 splice site probably null
IGL02550:Ncaph2 APN 15 89369861 nonsense probably null
IGL02884:Ncaph2 APN 15 89364244 critical splice donor site probably null
IGL03369:Ncaph2 APN 15 89363655 missense probably benign 0.43
R0051:Ncaph2 UTSW 15 89369664 missense probably damaging 0.98
R0384:Ncaph2 UTSW 15 89369391 missense probably benign 0.00
R1677:Ncaph2 UTSW 15 89371224 missense probably damaging 1.00
R1680:Ncaph2 UTSW 15 89364622 missense probably benign
R2570:Ncaph2 UTSW 15 89370475 missense probably benign 0.03
R4647:Ncaph2 UTSW 15 89370432 missense probably damaging 1.00
R4731:Ncaph2 UTSW 15 89355827 unclassified probably benign
R4795:Ncaph2 UTSW 15 89370807 missense probably damaging 1.00
R4796:Ncaph2 UTSW 15 89370807 missense probably damaging 1.00
R4917:Ncaph2 UTSW 15 89360371 missense probably damaging 1.00
R5089:Ncaph2 UTSW 15 89355945 critical splice donor site probably null
R6143:Ncaph2 UTSW 15 89364003 critical splice donor site probably null
R6500:Ncaph2 UTSW 15 89364204 missense probably benign 0.00
R6768:Ncaph2 UTSW 15 89363999 nonsense probably null
R6827:Ncaph2 UTSW 15 89371327 missense probably damaging 1.00
R7033:Ncaph2 UTSW 15 89371356 missense probably benign 0.00
R7272:Ncaph2 UTSW 15 89364182 missense probably benign
R7386:Ncaph2 UTSW 15 89370256 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAAACTGAAGTCCTCCCTGTGTCG -3'
(R):5'- GTACCACTTGTGGAAGTCCTGCAAC -3'

Sequencing Primer
(F):5'- CCTGTGTCGCTCTGGACTG -3'
(R):5'- AGTCCTGCAACTTGGTGGC -3'
Posted On2013-08-06