Incidental Mutation 'BB019:Myh8'
ID 643083
Institutional Source Beutler Lab
Gene Symbol Myh8
Ensembl Gene ENSMUSG00000055775
Gene Name myosin, heavy polypeptide 8, skeletal muscle, perinatal
Synonyms Myhsp, MyHC-pn, Myhs-p, 4832426G23Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.825) question?
Stock # BB019
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 67167950-67199460 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 67185430 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 894 (V894I)
Ref Sequence ENSEMBL: ENSMUSP00000019625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019625]
AlphaFold P13542
Predicted Effect probably benign
Transcript: ENSMUST00000019625
AA Change: V894I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000019625
Gene: ENSMUSG00000055775
AA Change: V894I

DomainStartEndE-ValueType
Pfam:Myosin_N 37 76 2.1e-13 PFAM
MYSc 82 782 N/A SMART
IQ 783 805 5.44e-3 SMART
Pfam:Myosin_tail_1 846 1927 2.4e-164 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer with two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. This gene is located in a cluster of related genes on chromosome 11. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,415,100 (GRCm39) R666G unknown Het
Adam21 T A 12: 81,606,938 (GRCm39) N275Y probably damaging Het
Arhgap24 A T 5: 102,993,835 (GRCm39) probably benign Het
Arhgef1 C T 7: 24,619,135 (GRCm39) L459F probably damaging Het
Bbx A T 16: 50,030,806 (GRCm39) probably null Het
Blk C T 14: 63,611,008 (GRCm39) G445S possibly damaging Het
Brca1 T C 11: 101,430,843 (GRCm39) E33G possibly damaging Het
Cacna1s T G 1: 136,012,097 (GRCm39) L513R probably damaging Het
Cnn3 T A 3: 121,245,078 (GRCm39) M98K probably benign Het
Cttnbp2 T A 6: 18,427,532 (GRCm39) L716F probably damaging Het
Dlgap1 A T 17: 70,823,233 (GRCm39) R73W probably damaging Het
Dnajc4 A G 19: 6,965,638 (GRCm39) L182P probably damaging Het
Dock2 T C 11: 34,217,998 (GRCm39) M1191V probably benign Het
Fam13a C T 6: 58,960,873 (GRCm39) probably null Het
Fbn2 C T 18: 58,153,555 (GRCm39) G2569E possibly damaging Het
Fes T C 7: 80,029,620 (GRCm39) I623V probably damaging Het
Fyco1 A C 9: 123,658,055 (GRCm39) L707R possibly damaging Het
Gadd45b T A 10: 80,766,169 (GRCm39) V7E possibly damaging Het
Gm19410 T A 8: 36,262,753 (GRCm39) C897S probably damaging Het
Hk1 A G 10: 62,151,299 (GRCm39) L31P probably damaging Het
Hoxa4 T G 6: 52,167,397 (GRCm39) K261N probably damaging Het
Hrh4 T A 18: 13,148,869 (GRCm39) L77* probably null Het
Igf1r A T 7: 67,861,802 (GRCm39) I1121F possibly damaging Het
Igkv16-104 A T 6: 68,402,778 (GRCm39) I24L probably benign Het
Itk A T 11: 46,231,519 (GRCm39) W346R probably benign Het
Kdm2a A G 19: 4,369,184 (GRCm39) S1144P probably damaging Het
Krt86 A T 15: 101,374,473 (GRCm39) S289C probably damaging Het
Lonrf1 T C 8: 36,690,070 (GRCm39) I663V probably benign Het
Lrp2 T G 2: 69,256,371 (GRCm39) I4590L probably benign Het
Lrrc8d C T 5: 105,960,891 (GRCm39) R434C probably damaging Het
Maneal T C 4: 124,755,638 (GRCm39) Y108C probably damaging Het
Ncam2 T G 16: 81,412,708 (GRCm39) L732R probably damaging Het
Nsun4 A T 4: 115,901,997 (GRCm39) D156E probably damaging Het
Or10z1 T C 1: 174,078,260 (GRCm39) I78V probably benign Het
Or1e23 A C 11: 73,407,983 (GRCm39) L14R probably damaging Het
Or2n1d A T 17: 38,646,146 (GRCm39) I33L probably benign Het
Or5b106 A T 19: 13,123,345 (GRCm39) M226K probably benign Het
Or5v1b T C 17: 37,841,075 (GRCm39) I69T probably benign Het
Or6c66 C A 10: 129,461,094 (GRCm39) V279F probably damaging Het
P2rx7 G A 5: 122,782,245 (GRCm39) V37I probably benign Het
Pcdh15 A G 10: 74,481,359 (GRCm39) R235G probably benign Het
Pcdhga1 T C 18: 37,796,513 (GRCm39) S506P probably damaging Het
Pira2 A T 7: 3,845,435 (GRCm39) probably null Het
Plch1 A G 3: 63,609,402 (GRCm39) V935A probably benign Het
Plscr4 C T 9: 92,372,843 (GRCm39) R322* probably null Het
Prpf8 A G 11: 75,383,423 (GRCm39) D607G possibly damaging Het
Ptdss1 T C 13: 67,114,496 (GRCm39) W215R probably damaging Het
Ptpn9 C A 9: 56,943,900 (GRCm39) P258Q possibly damaging Het
Rfpl4b A G 10: 38,697,346 (GRCm39) V85A possibly damaging Het
Sacs C A 14: 61,442,327 (GRCm39) Q1458K probably damaging Het
Scfd2 A T 5: 74,692,211 (GRCm39) S24T probably benign Het
Siae A G 9: 37,544,980 (GRCm39) D325G probably benign Het
Slc22a23 C A 13: 34,366,960 (GRCm39) A683S probably damaging Het
Slc44a3 A T 3: 121,306,009 (GRCm39) I244N possibly damaging Het
Srrm2 T A 17: 24,037,501 (GRCm39) S1382T probably benign Het
Tfap2c A G 2: 172,393,706 (GRCm39) Y207C probably damaging Het
Timd5 C A 11: 46,426,366 (GRCm39) P158T probably benign Het
Tnc T C 4: 63,926,857 (GRCm39) I890V probably benign Het
Trim30a A T 7: 104,078,545 (GRCm39) I177N probably benign Het
Tshz2 T A 2: 169,728,251 (GRCm39) M949K possibly damaging Het
Ttn T G 2: 76,555,530 (GRCm39) T30492P probably damaging Het
Ubb C T 11: 62,443,611 (GRCm39) Q214* probably null Het
Ulk2 A G 11: 61,698,916 (GRCm39) S423P probably benign Het
Vmn1r237 C A 17: 21,534,725 (GRCm39) D149E probably benign Het
Zbtb24 A G 10: 41,327,504 (GRCm39) D130G probably benign Het
Zfp689 C A 7: 127,043,523 (GRCm39) G369V probably damaging Het
Zg16 A G 7: 126,649,577 (GRCm39) F128S probably damaging Het
Zmym1 T G 4: 126,944,578 (GRCm39) N203T possibly damaging Het
Other mutations in Myh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Myh8 APN 11 67,174,644 (GRCm39) missense probably damaging 0.97
IGL01020:Myh8 APN 11 67,174,229 (GRCm39) missense probably damaging 0.99
IGL01348:Myh8 APN 11 67,188,606 (GRCm39) missense probably damaging 1.00
IGL01382:Myh8 APN 11 67,192,799 (GRCm39) missense probably damaging 1.00
IGL01454:Myh8 APN 11 67,174,422 (GRCm39) missense probably damaging 1.00
IGL01457:Myh8 APN 11 67,183,505 (GRCm39) missense probably benign 0.00
IGL01472:Myh8 APN 11 67,179,205 (GRCm39) splice site probably benign
IGL01473:Myh8 APN 11 67,192,651 (GRCm39) critical splice donor site probably null
IGL01613:Myh8 APN 11 67,192,536 (GRCm39) missense probably benign 0.11
IGL01763:Myh8 APN 11 67,177,245 (GRCm39) missense probably benign 0.01
IGL01828:Myh8 APN 11 67,194,652 (GRCm39) missense possibly damaging 0.82
IGL01862:Myh8 APN 11 67,180,520 (GRCm39) nonsense probably null
IGL01905:Myh8 APN 11 67,175,477 (GRCm39) missense possibly damaging 0.90
IGL02280:Myh8 APN 11 67,174,198 (GRCm39) unclassified probably benign
IGL02386:Myh8 APN 11 67,185,266 (GRCm39) missense probably damaging 0.99
IGL02449:Myh8 APN 11 67,185,440 (GRCm39) critical splice donor site probably null
IGL02500:Myh8 APN 11 67,196,536 (GRCm39) missense probably benign 0.00
IGL02745:Myh8 APN 11 67,188,327 (GRCm39) missense possibly damaging 0.88
IGL02799:Myh8 APN 11 67,192,418 (GRCm39) splice site probably benign
IGL03063:Myh8 APN 11 67,179,031 (GRCm39) missense probably benign 0.00
IGL03223:Myh8 APN 11 67,174,644 (GRCm39) missense probably damaging 0.97
IGL03336:Myh8 APN 11 67,175,528 (GRCm39) missense probably damaging 1.00
IGL03338:Myh8 APN 11 67,189,172 (GRCm39) missense probably damaging 1.00
IGL03351:Myh8 APN 11 67,194,739 (GRCm39) missense possibly damaging 0.94
IGL03392:Myh8 APN 11 67,185,244 (GRCm39) missense probably damaging 1.00
BB003:Myh8 UTSW 11 67,169,732 (GRCm39) missense possibly damaging 0.94
BB009:Myh8 UTSW 11 67,185,430 (GRCm39) missense probably benign 0.00
BB013:Myh8 UTSW 11 67,169,732 (GRCm39) missense possibly damaging 0.94
PIT4354001:Myh8 UTSW 11 67,180,456 (GRCm39) missense probably benign 0.01
R0012:Myh8 UTSW 11 67,190,847 (GRCm39) missense probably benign 0.02
R0016:Myh8 UTSW 11 67,189,351 (GRCm39) missense probably damaging 1.00
R0016:Myh8 UTSW 11 67,189,351 (GRCm39) missense probably damaging 1.00
R0115:Myh8 UTSW 11 67,197,090 (GRCm39) splice site probably benign
R0131:Myh8 UTSW 11 67,183,014 (GRCm39) missense probably damaging 0.96
R0131:Myh8 UTSW 11 67,183,014 (GRCm39) missense probably damaging 0.96
R0132:Myh8 UTSW 11 67,183,014 (GRCm39) missense probably damaging 0.96
R0238:Myh8 UTSW 11 67,192,518 (GRCm39) missense probably benign 0.00
R0238:Myh8 UTSW 11 67,192,518 (GRCm39) missense probably benign 0.00
R0239:Myh8 UTSW 11 67,192,518 (GRCm39) missense probably benign 0.00
R0239:Myh8 UTSW 11 67,192,518 (GRCm39) missense probably benign 0.00
R0393:Myh8 UTSW 11 67,196,843 (GRCm39) splice site probably benign
R0453:Myh8 UTSW 11 67,183,731 (GRCm39) missense probably benign 0.03
R0454:Myh8 UTSW 11 67,194,591 (GRCm39) nonsense probably null
R0466:Myh8 UTSW 11 67,189,405 (GRCm39) missense probably benign 0.01
R0487:Myh8 UTSW 11 67,192,837 (GRCm39) missense probably benign
R0511:Myh8 UTSW 11 67,175,333 (GRCm39) missense probably benign 0.01
R0557:Myh8 UTSW 11 67,192,624 (GRCm39) missense possibly damaging 0.88
R0589:Myh8 UTSW 11 67,189,453 (GRCm39) missense probably benign 0.00
R0658:Myh8 UTSW 11 67,175,358 (GRCm39) critical splice donor site probably null
R0782:Myh8 UTSW 11 67,180,580 (GRCm39) missense probably benign 0.16
R0829:Myh8 UTSW 11 67,174,326 (GRCm39) unclassified probably benign
R0845:Myh8 UTSW 11 67,177,090 (GRCm39) missense probably damaging 1.00
R0930:Myh8 UTSW 11 67,196,824 (GRCm39) missense possibly damaging 0.93
R0972:Myh8 UTSW 11 67,188,585 (GRCm39) missense probably damaging 1.00
R1132:Myh8 UTSW 11 67,187,957 (GRCm39) nonsense probably null
R1417:Myh8 UTSW 11 67,197,011 (GRCm39) missense probably damaging 1.00
R1478:Myh8 UTSW 11 67,183,551 (GRCm39) missense probably benign 0.23
R1497:Myh8 UTSW 11 67,180,638 (GRCm39) missense probably benign 0.00
R1605:Myh8 UTSW 11 67,192,497 (GRCm39) missense probably damaging 0.99
R1701:Myh8 UTSW 11 67,170,964 (GRCm39) missense probably damaging 1.00
R1950:Myh8 UTSW 11 67,169,830 (GRCm39) missense possibly damaging 0.75
R1989:Myh8 UTSW 11 67,183,550 (GRCm39) missense probably benign 0.00
R2010:Myh8 UTSW 11 67,187,990 (GRCm39) nonsense probably null
R2095:Myh8 UTSW 11 67,177,050 (GRCm39) missense probably benign 0.00
R2132:Myh8 UTSW 11 67,183,702 (GRCm39) missense probably damaging 1.00
R2152:Myh8 UTSW 11 67,185,295 (GRCm39) missense probably damaging 0.97
R2229:Myh8 UTSW 11 67,199,174 (GRCm39) missense probably damaging 0.98
R2302:Myh8 UTSW 11 67,177,065 (GRCm39) missense probably damaging 1.00
R2364:Myh8 UTSW 11 67,185,344 (GRCm39) missense probably benign 0.03
R2429:Myh8 UTSW 11 67,194,723 (GRCm39) missense probably benign 0.21
R2880:Myh8 UTSW 11 67,188,090 (GRCm39) missense probably damaging 0.97
R3692:Myh8 UTSW 11 67,192,744 (GRCm39) missense probably damaging 0.98
R3756:Myh8 UTSW 11 67,175,443 (GRCm39) unclassified probably benign
R3924:Myh8 UTSW 11 67,187,963 (GRCm39) missense probably damaging 0.99
R4172:Myh8 UTSW 11 67,183,247 (GRCm39) missense probably damaging 1.00
R4255:Myh8 UTSW 11 67,190,560 (GRCm39) missense probably benign
R4621:Myh8 UTSW 11 67,177,084 (GRCm39) missense probably damaging 1.00
R4623:Myh8 UTSW 11 67,177,084 (GRCm39) missense probably damaging 1.00
R4790:Myh8 UTSW 11 67,170,789 (GRCm39) missense probably damaging 0.99
R4914:Myh8 UTSW 11 67,183,510 (GRCm39) missense probably damaging 1.00
R5074:Myh8 UTSW 11 67,196,742 (GRCm39) missense possibly damaging 0.79
R5119:Myh8 UTSW 11 67,189,184 (GRCm39) missense probably damaging 1.00
R5159:Myh8 UTSW 11 67,179,179 (GRCm39) missense probably damaging 0.99
R5229:Myh8 UTSW 11 67,175,310 (GRCm39) missense probably damaging 0.96
R5320:Myh8 UTSW 11 67,177,089 (GRCm39) missense probably damaging 1.00
R5455:Myh8 UTSW 11 67,192,244 (GRCm39) missense possibly damaging 0.59
R5523:Myh8 UTSW 11 67,196,788 (GRCm39) missense possibly damaging 0.95
R5540:Myh8 UTSW 11 67,177,266 (GRCm39) missense probably benign 0.00
R5726:Myh8 UTSW 11 67,185,392 (GRCm39) missense possibly damaging 0.79
R5770:Myh8 UTSW 11 67,188,026 (GRCm39) missense probably damaging 1.00
R6135:Myh8 UTSW 11 67,188,326 (GRCm39) missense possibly damaging 0.51
R6253:Myh8 UTSW 11 67,192,793 (GRCm39) missense probably benign 0.06
R6318:Myh8 UTSW 11 67,190,167 (GRCm39) missense probably benign 0.00
R6432:Myh8 UTSW 11 67,189,405 (GRCm39) missense probably benign 0.01
R6452:Myh8 UTSW 11 67,196,565 (GRCm39) missense possibly damaging 0.88
R6452:Myh8 UTSW 11 67,183,275 (GRCm39) missense probably benign 0.27
R6512:Myh8 UTSW 11 67,180,488 (GRCm39) nonsense probably null
R6714:Myh8 UTSW 11 67,197,775 (GRCm39) missense probably damaging 1.00
R6842:Myh8 UTSW 11 67,175,481 (GRCm39) missense probably damaging 1.00
R7007:Myh8 UTSW 11 67,179,142 (GRCm39) missense probably benign 0.03
R7025:Myh8 UTSW 11 67,188,365 (GRCm39) missense probably benign 0.02
R7086:Myh8 UTSW 11 67,183,453 (GRCm39) splice site probably null
R7098:Myh8 UTSW 11 67,169,879 (GRCm39) missense probably benign 0.03
R7498:Myh8 UTSW 11 67,174,263 (GRCm39) missense possibly damaging 0.80
R7716:Myh8 UTSW 11 67,189,478 (GRCm39) missense possibly damaging 0.51
R7765:Myh8 UTSW 11 67,194,481 (GRCm39) missense probably benign 0.44
R7825:Myh8 UTSW 11 67,194,538 (GRCm39) missense possibly damaging 0.94
R7921:Myh8 UTSW 11 67,174,644 (GRCm39) missense probably damaging 0.97
R7926:Myh8 UTSW 11 67,169,732 (GRCm39) missense possibly damaging 0.94
R7932:Myh8 UTSW 11 67,185,430 (GRCm39) missense probably benign 0.00
R8003:Myh8 UTSW 11 67,190,586 (GRCm39) missense probably damaging 1.00
R8028:Myh8 UTSW 11 67,194,502 (GRCm39) missense possibly damaging 0.65
R8121:Myh8 UTSW 11 67,180,647 (GRCm39) missense probably benign 0.00
R8125:Myh8 UTSW 11 67,190,598 (GRCm39) missense possibly damaging 0.94
R8170:Myh8 UTSW 11 67,179,092 (GRCm39) missense probably benign 0.30
R8277:Myh8 UTSW 11 67,183,735 (GRCm39) missense probably benign 0.10
R8304:Myh8 UTSW 11 67,195,162 (GRCm39) missense possibly damaging 0.72
R8431:Myh8 UTSW 11 67,174,440 (GRCm39) missense possibly damaging 0.94
R8535:Myh8 UTSW 11 67,169,741 (GRCm39) missense probably damaging 1.00
R8795:Myh8 UTSW 11 67,174,203 (GRCm39) critical splice acceptor site probably benign
R8858:Myh8 UTSW 11 67,192,820 (GRCm39) missense possibly damaging 0.67
R8927:Myh8 UTSW 11 67,174,081 (GRCm39) missense probably benign 0.10
R8928:Myh8 UTSW 11 67,174,081 (GRCm39) missense probably benign 0.10
R9031:Myh8 UTSW 11 67,190,141 (GRCm39) missense possibly damaging 0.49
R9172:Myh8 UTSW 11 67,183,260 (GRCm39) missense possibly damaging 0.82
R9252:Myh8 UTSW 11 67,177,302 (GRCm39) missense probably damaging 1.00
R9365:Myh8 UTSW 11 67,174,632 (GRCm39) missense probably benign 0.42
R9468:Myh8 UTSW 11 67,197,730 (GRCm39) missense probably damaging 1.00
R9564:Myh8 UTSW 11 67,177,215 (GRCm39) missense probably benign 0.40
R9565:Myh8 UTSW 11 67,177,215 (GRCm39) missense probably benign 0.40
T0722:Myh8 UTSW 11 67,195,262 (GRCm39) missense probably benign 0.41
Z1088:Myh8 UTSW 11 67,189,418 (GRCm39) missense probably damaging 1.00
Z1176:Myh8 UTSW 11 67,194,500 (GRCm39) missense probably damaging 1.00
Z1177:Myh8 UTSW 11 67,199,181 (GRCm39) missense possibly damaging 0.64
Z1177:Myh8 UTSW 11 67,192,250 (GRCm39) missense probably damaging 0.99
Z1187:Myh8 UTSW 11 67,188,312 (GRCm39) missense probably benign
Z1188:Myh8 UTSW 11 67,188,312 (GRCm39) missense probably benign
Z1190:Myh8 UTSW 11 67,188,312 (GRCm39) missense probably benign
Z1191:Myh8 UTSW 11 67,188,312 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTGGCCCTGGATGAAACTC -3'
(R):5'- CCCTGTGTAATGTAGAAGTAGCTG -3'

Sequencing Primer
(F):5'- GCCCTGGATGAAACTCTTCTTCAAG -3'
(R):5'- TCTTCCTCAACACACTATTGAAAGG -3'
Posted On 2020-08-01