Incidental Mutation 'BB020:Sprr3'
ID643109
Institutional Source Beutler Lab
Gene Symbol Sprr3
Ensembl Gene ENSMUSG00000045539
Gene Namesmall proline-rich protein 3
SynonymsSPR3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #BB020
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location92456502-92458720 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92457208 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 110 (I110V)
Ref Sequence ENSEMBL: ENSMUSP00000056287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058142]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058142
AA Change: I110V

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000056287
Gene: ENSMUSG00000045539
AA Change: I110V

DomainStartEndE-ValueType
Pfam:Cornifin 17 142 1.3e-35 PFAM
Pfam:Cornifin 125 236 3.9e-26 PFAM
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,751 L85P probably damaging Het
4933414I15Rik A G 11: 50,942,400 V125A unknown Het
Adam34 T A 8: 43,650,874 H578L probably damaging Het
Ago4 A T 4: 126,507,018 M678K probably benign Het
Atrn T C 2: 130,995,066 L1150P probably damaging Het
Camta1 C T 4: 151,083,757 E279K probably damaging Het
Ccdc88c T C 12: 100,945,490 D695G possibly damaging Het
Col11a2 A T 17: 34,056,055 K400* probably null Het
Cpsf4 T A 5: 145,167,358 M1K probably null Het
Dnah12 A T 14: 26,766,115 Q992L probably benign Het
Dnajc7 T C 11: 100,596,212 Y145C probably damaging Het
Eml5 A T 12: 98,844,020 D892E possibly damaging Het
Fam193a A G 5: 34,466,195 K23E possibly damaging Het
Fam214b A T 4: 43,035,919 C271S probably benign Het
Filip1 T G 9: 79,820,047 K430T possibly damaging Het
Gm5089 T C 14: 122,435,991 D106G unknown Het
Hip1 A T 5: 135,460,456 N45K probably damaging Het
Hivep2 T C 10: 14,127,837 S60P probably damaging Het
Ighv1-53 A T 12: 115,158,409 C115* probably null Het
Macf1 T C 4: 123,409,651 T353A probably benign Het
Mast3 A T 8: 70,786,635 V433E probably damaging Het
Mast4 A T 13: 102,772,563 M660K probably damaging Het
Nr2e1 T C 10: 42,563,383 Y380C probably damaging Het
Olfr1465 T A 19: 13,314,205 M27L probably benign Het
Otog A G 7: 46,310,147 D720G probably damaging Het
Slc6a1 T A 6: 114,311,898 W473R probably damaging Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Ston1 A G 17: 88,636,144 E326G probably benign Het
Tapbpl T G 6: 125,230,270 Q152P probably damaging Het
Tectb C T 19: 55,194,673 L319F possibly damaging Het
Tpp2 G A 1: 43,960,961 G413D probably damaging Het
Tpsg1 A G 17: 25,373,204 H84R probably damaging Het
Usp24 A G 4: 106,428,489 N2437S probably benign Het
Usp32 T C 11: 85,007,059 Q1152R probably damaging Het
Vmn2r6 T C 3: 64,559,803 T92A probably benign Het
Xpo7 A G 14: 70,707,348 V35A probably benign Het
Zan T A 5: 137,463,579 T1113S unknown Het
Zfp169 A G 13: 48,490,481 V390A unknown Het
Other mutations in Sprr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02557:Sprr3 APN 3 92457166 missense possibly damaging 0.95
BB010:Sprr3 UTSW 3 92457208 missense possibly damaging 0.66
R0070:Sprr3 UTSW 3 92457302 missense probably benign
R0512:Sprr3 UTSW 3 92457477 missense possibly damaging 0.71
R0907:Sprr3 UTSW 3 92457009 missense probably benign 0.09
R1976:Sprr3 UTSW 3 92456946 missense possibly damaging 0.52
R4241:Sprr3 UTSW 3 92456907 missense possibly damaging 0.92
R4503:Sprr3 UTSW 3 92457376 missense possibly damaging 0.51
R7622:Sprr3 UTSW 3 92457285 missense probably damaging 0.98
R7753:Sprr3 UTSW 3 92457108 missense probably benign 0.18
R7933:Sprr3 UTSW 3 92457208 missense possibly damaging 0.66
R8061:Sprr3 UTSW 3 92456877 missense probably damaging 0.98
R8742:Sprr3 UTSW 3 92457000 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGCATGGTTCTGAGCTTGGC -3'
(R):5'- ATGCCACACAGATGTTCCAC -3'

Sequencing Primer
(F):5'- AGCTTGGCTCAGAAGTACTG -3'
(R):5'- ACAGATGTTCCACAACCAGG -3'
Posted On2020-08-01