Incidental Mutation 'BB020:Fam214b'
ID643110
Institutional Source Beutler Lab
Gene Symbol Fam214b
Ensembl Gene ENSMUSG00000036002
Gene Namefamily with sequence similarity 214, member B
SynonymsB230312A22Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #BB020
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location43032414-43046220 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43035919 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 271 (C271S)
Ref Sequence ENSEMBL: ENSMUSP00000038177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030169] [ENSMUST00000036462] [ENSMUST00000107956] [ENSMUST00000107957] [ENSMUST00000107958] [ENSMUST00000107959] [ENSMUST00000124155] [ENSMUST00000135067] [ENSMUST00000136326] [ENSMUST00000138030] [ENSMUST00000144999] [ENSMUST00000152846]
Predicted Effect probably benign
Transcript: ENSMUST00000030169
SMART Domains Protein: ENSMUSP00000030169
Gene: ENSMUSG00000028455

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PHB 36 194 1.47e-57 SMART
coiled coil region 231 252 N/A INTRINSIC
Pfam:Band_7_C 259 321 2.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036462
AA Change: C271S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038177
Gene: ENSMUSG00000036002
AA Change: C271S

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107956
AA Change: C271S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103590
Gene: ENSMUSG00000036002
AA Change: C271S

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107957
AA Change: C271S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103591
Gene: ENSMUSG00000036002
AA Change: C271S

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107958
AA Change: C271S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103592
Gene: ENSMUSG00000036002
AA Change: C271S

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107959
AA Change: C271S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103593
Gene: ENSMUSG00000036002
AA Change: C271S

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 480 537 8.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124155
Predicted Effect probably benign
Transcript: ENSMUST00000135067
AA Change: C271S

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000122882
Gene: ENSMUSG00000036002
AA Change: C271S

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136326
SMART Domains Protein: ENSMUSP00000117586
Gene: ENSMUSG00000028455

DomainStartEndE-ValueType
PHB 1 148 1.33e-37 SMART
coiled coil region 185 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138030
SMART Domains Protein: ENSMUSP00000118465
Gene: ENSMUSG00000028455

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PHB 42 200 1.47e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144999
Predicted Effect probably benign
Transcript: ENSMUST00000152846
SMART Domains Protein: ENSMUSP00000118228
Gene: ENSMUSG00000036002

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,751 L85P probably damaging Het
4933414I15Rik A G 11: 50,942,400 V125A unknown Het
Adam34 T A 8: 43,650,874 H578L probably damaging Het
Ago4 A T 4: 126,507,018 M678K probably benign Het
Atrn T C 2: 130,995,066 L1150P probably damaging Het
Camta1 C T 4: 151,083,757 E279K probably damaging Het
Ccdc88c T C 12: 100,945,490 D695G possibly damaging Het
Col11a2 A T 17: 34,056,055 K400* probably null Het
Cpsf4 T A 5: 145,167,358 M1K probably null Het
Dnah12 A T 14: 26,766,115 Q992L probably benign Het
Dnajc7 T C 11: 100,596,212 Y145C probably damaging Het
Eml5 A T 12: 98,844,020 D892E possibly damaging Het
Fam193a A G 5: 34,466,195 K23E possibly damaging Het
Filip1 T G 9: 79,820,047 K430T possibly damaging Het
Gm5089 T C 14: 122,435,991 D106G unknown Het
Hip1 A T 5: 135,460,456 N45K probably damaging Het
Hivep2 T C 10: 14,127,837 S60P probably damaging Het
Ighv1-53 A T 12: 115,158,409 C115* probably null Het
Macf1 T C 4: 123,409,651 T353A probably benign Het
Mast3 A T 8: 70,786,635 V433E probably damaging Het
Mast4 A T 13: 102,772,563 M660K probably damaging Het
Nr2e1 T C 10: 42,563,383 Y380C probably damaging Het
Olfr1465 T A 19: 13,314,205 M27L probably benign Het
Otog A G 7: 46,310,147 D720G probably damaging Het
Slc6a1 T A 6: 114,311,898 W473R probably damaging Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Sprr3 T C 3: 92,457,208 I110V possibly damaging Het
Ston1 A G 17: 88,636,144 E326G probably benign Het
Tapbpl T G 6: 125,230,270 Q152P probably damaging Het
Tectb C T 19: 55,194,673 L319F possibly damaging Het
Tpp2 G A 1: 43,960,961 G413D probably damaging Het
Tpsg1 A G 17: 25,373,204 H84R probably damaging Het
Usp24 A G 4: 106,428,489 N2437S probably benign Het
Usp32 T C 11: 85,007,059 Q1152R probably damaging Het
Vmn2r6 T C 3: 64,559,803 T92A probably benign Het
Xpo7 A G 14: 70,707,348 V35A probably benign Het
Zan T A 5: 137,463,579 T1113S unknown Het
Zfp169 A G 13: 48,490,481 V390A unknown Het
Other mutations in Fam214b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02268:Fam214b APN 4 43036468 nonsense probably null
IGL02810:Fam214b APN 4 43034429 missense probably damaging 1.00
BB010:Fam214b UTSW 4 43035919 missense probably benign
PIT4431001:Fam214b UTSW 4 43036024 missense probably damaging 0.99
R0049:Fam214b UTSW 4 43036441 missense probably benign 0.30
R0049:Fam214b UTSW 4 43036441 missense probably benign 0.30
R0565:Fam214b UTSW 4 43034647 unclassified probably benign
R0627:Fam214b UTSW 4 43036242 missense probably damaging 1.00
R1121:Fam214b UTSW 4 43034947 missense probably damaging 1.00
R2395:Fam214b UTSW 4 43035964 nonsense probably null
R2853:Fam214b UTSW 4 43036293 missense probably benign
R3878:Fam214b UTSW 4 43035867 missense probably damaging 1.00
R4688:Fam214b UTSW 4 43034663 missense probably damaging 1.00
R6467:Fam214b UTSW 4 43033687 missense probably damaging 1.00
R6556:Fam214b UTSW 4 43033896 missense probably damaging 0.96
R7107:Fam214b UTSW 4 43036434 missense probably benign 0.10
R7608:Fam214b UTSW 4 43036533 missense probably damaging 0.99
R7933:Fam214b UTSW 4 43035919 missense probably benign
R7982:Fam214b UTSW 4 43034483 missense probably damaging 1.00
R8017:Fam214b UTSW 4 43034413 missense probably damaging 1.00
R8328:Fam214b UTSW 4 43034751 missense probably benign
R8715:Fam214b UTSW 4 43033944 missense possibly damaging 0.80
R8792:Fam214b UTSW 4 43033546 missense probably damaging 0.99
R8837:Fam214b UTSW 4 43034531 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCCTTCGAACTCTCCGGAAG -3'
(R):5'- GCACAATCTTGCACAAATAGGGG -3'

Sequencing Primer
(F):5'- TTGCCTGGGATACATAAGACC -3'
(R):5'- TCTTGCACAAATAGGGGGTAAG -3'
Posted On2020-08-01