Incidental Mutation 'R0051:Impg2'
ID64312
Institutional Source Beutler Lab
Gene Symbol Impg2
Ensembl Gene ENSMUSG00000035270
Gene Nameinterphotoreceptor matrix proteoglycan 2
SynonymsIPM200, Spacrcan, PG10.2
MMRRC Submission 038345-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R0051 (G1)
Quality Score122
Status Validated
Chromosome16
Chromosomal Location56204313-56273756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56258048 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 458 (S458T)
Ref Sequence ENSEMBL: ENSMUSP00000063648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069936] [ENSMUST00000160116]
Predicted Effect probably damaging
Transcript: ENSMUST00000069936
AA Change: S458T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063648
Gene: ENSMUSG00000035270
AA Change: S458T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 66 74 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
SEA 235 345 7.7e-29 SMART
low complexity region 396 407 N/A INTRINSIC
low complexity region 419 444 N/A INTRINSIC
SEA 895 1018 2.18e-28 SMART
EGF_like 1016 1054 3.57e1 SMART
EGF_like 1056 1096 3.04e1 SMART
transmembrane domain 1105 1127 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160116
SMART Domains Protein: ENSMUSP00000125135
Gene: ENSMUSG00000035270

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 66 74 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
SEA 235 345 7.7e-29 SMART
SEA 786 909 2.18e-28 SMART
EGF_like 907 945 3.57e1 SMART
EGF_like 947 987 3.04e1 SMART
transmembrane domain 996 1018 N/A INTRINSIC
Meta Mutation Damage Score 0.0613 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds chondroitin sulfate and hyaluronan and is a proteoglycan. The encoded protein plays a role in the organization of the interphotoreceptor matrix and may promote the growth and maintenance of the light-sensitive photoreceptor outer segment. Defects in this gene are a cause of retinitis pigmentosa type 56 and maculopathy, IMPG2-related.[provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,579,101 noncoding transcript Het
Abr T A 11: 76,472,502 Q163L probably benign Het
AI314180 A G 4: 58,832,729 L877S probably damaging Het
Ankrd11 C A 8: 122,889,742 C2457F probably damaging Het
Anks3 G C 16: 4,947,749 T163S probably benign Het
Cacna1d G A 14: 30,111,095 P908S probably damaging Het
Ccdc146 C A 5: 21,316,904 R374L possibly damaging Het
Cdc45 G T 16: 18,794,774 A348E probably damaging Het
Cfap46 A G 7: 139,676,035 C300R probably damaging Het
Coq2 T C 5: 100,663,685 N146S probably benign Het
Dalrd3 T C 9: 108,572,215 V120A possibly damaging Het
Dcp2 T A 18: 44,405,374 probably benign Het
Ddx39 A G 8: 83,720,622 K137R possibly damaging Het
Diaph3 A G 14: 87,037,454 probably null Het
Dmbt1 G T 7: 131,119,496 R1668L possibly damaging Het
Dnah7a T G 1: 53,521,086 probably benign Het
Dpp7 A G 2: 25,356,095 Y49H possibly damaging Het
Drd5 A G 5: 38,320,614 S317G probably benign Het
Ecsit C T 9: 22,076,288 V152I probably benign Het
Emc1 T A 4: 139,375,163 M923K possibly damaging Het
Fam102a G A 2: 32,558,053 R58Q possibly damaging Het
Fcrl6 A T 1: 172,598,753 L159Q probably benign Het
Frrs1 T C 3: 116,885,297 probably benign Het
Hspd1 A G 1: 55,082,046 probably benign Het
Klf17 T C 4: 117,760,392 Y256C probably damaging Het
Lnx2 A G 5: 147,029,353 F319L probably damaging Het
Mafg G T 11: 120,629,604 R57S probably damaging Het
Med13l T A 5: 118,742,655 W1271R probably damaging Het
Mrgprb1 A G 7: 48,447,214 S24P probably benign Het
Mtrf1l T C 10: 5,813,384 E315G probably damaging Het
Naip1 T C 13: 100,411,001 E1239G probably damaging Het
Ncaph2 T C 15: 89,369,664 S320P probably damaging Het
Nek11 A G 9: 105,218,539 probably benign Het
Nlrp2 A T 7: 5,322,334 probably benign Het
Odf3 C A 7: 140,850,221 probably benign Het
Rbm26 A C 14: 105,152,540 V216G possibly damaging Het
Rnf115 A G 3: 96,785,022 D178G probably damaging Het
Rtel1 C T 2: 181,350,656 Q424* probably null Het
Rwdd4a A G 8: 47,537,365 probably benign Het
Ryr3 T C 2: 112,869,075 D890G probably damaging Het
Scarb1 C A 5: 125,281,100 probably null Het
Serpina10 A G 12: 103,626,897 probably benign Het
Slc12a5 T A 2: 164,986,663 W508R probably damaging Het
Slc43a2 T C 11: 75,562,850 C225R probably damaging Het
Slc6a9 T C 4: 117,864,859 F440L probably damaging Het
Stac3 G A 10: 127,508,148 R305H probably damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Syna A T 5: 134,559,543 L184H probably damaging Het
Tmprss7 T C 16: 45,673,939 N401S probably damaging Het
Yeats2 T A 16: 20,193,724 Y557* probably null Het
Zcchc11 T G 4: 108,527,004 S1089R probably damaging Het
Zfp352 T C 4: 90,224,285 S221P probably damaging Het
Zfp575 A G 7: 24,586,087 V43A probably benign Het
Zfp775 A G 6: 48,620,772 T527A probably benign Het
Other mutations in Impg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Impg2 APN 16 56261605 nonsense probably null
IGL01097:Impg2 APN 16 56260647 critical splice donor site probably null
IGL01115:Impg2 APN 16 56259440 missense possibly damaging 0.61
IGL01545:Impg2 APN 16 56225717 splice site probably benign
IGL01644:Impg2 APN 16 56259870 missense probably benign 0.04
IGL01690:Impg2 APN 16 56205205 missense probably damaging 0.97
IGL01781:Impg2 APN 16 56252225 missense probably benign 0.21
IGL01801:Impg2 APN 16 56236748 missense probably damaging 0.97
IGL01980:Impg2 APN 16 56221527 missense probably damaging 0.99
IGL02059:Impg2 APN 16 56259972 missense probably damaging 1.00
IGL02140:Impg2 APN 16 56259468 missense probably benign 0.05
IGL02206:Impg2 APN 16 56259597 missense possibly damaging 0.92
IGL02245:Impg2 APN 16 56269082 missense probably damaging 0.96
IGL02584:Impg2 APN 16 56265011 missense probably damaging 1.00
IGL03061:Impg2 APN 16 56268416 missense probably damaging 1.00
IGL03123:Impg2 APN 16 56267122 missense probably damaging 1.00
IGL03280:Impg2 APN 16 56268268 nonsense probably null
R0117:Impg2 UTSW 16 56261642 missense probably damaging 0.99
R0193:Impg2 UTSW 16 56265049 nonsense probably null
R0270:Impg2 UTSW 16 56269015 missense possibly damaging 0.88
R0326:Impg2 UTSW 16 56260485 missense probably damaging 1.00
R0330:Impg2 UTSW 16 56252264 missense probably damaging 0.99
R0812:Impg2 UTSW 16 56257939 intron probably benign
R1074:Impg2 UTSW 16 56265178 splice site probably benign
R1283:Impg2 UTSW 16 56257939 intron probably benign
R1618:Impg2 UTSW 16 56259858 missense probably damaging 0.97
R1708:Impg2 UTSW 16 56265078 missense probably benign 0.10
R1713:Impg2 UTSW 16 56260526 missense probably benign 0.25
R1827:Impg2 UTSW 16 56267220 missense possibly damaging 0.62
R1853:Impg2 UTSW 16 56260277 missense probably damaging 1.00
R2064:Impg2 UTSW 16 56243630 critical splice donor site probably null
R2100:Impg2 UTSW 16 56231385 splice site probably null
R2125:Impg2 UTSW 16 56265064 missense probably damaging 1.00
R2128:Impg2 UTSW 16 56218379 missense probably damaging 1.00
R2195:Impg2 UTSW 16 56260134 missense probably benign 0.39
R2247:Impg2 UTSW 16 56268264 missense probably damaging 0.97
R2366:Impg2 UTSW 16 56259873 missense probably benign 0.04
R2411:Impg2 UTSW 16 56252154 missense probably damaging 1.00
R4193:Impg2 UTSW 16 56268411 missense probably benign 0.00
R4356:Impg2 UTSW 16 56260164 missense probably damaging 1.00
R4424:Impg2 UTSW 16 56260025 missense possibly damaging 0.56
R4575:Impg2 UTSW 16 56261732 missense probably damaging 1.00
R4766:Impg2 UTSW 16 56257939 intron probably benign
R5024:Impg2 UTSW 16 56260100 missense probably damaging 0.97
R5278:Impg2 UTSW 16 56221517 missense probably benign 0.06
R5383:Impg2 UTSW 16 56243626 missense probably benign 0.03
R5766:Impg2 UTSW 16 56259820 missense possibly damaging 0.73
R5909:Impg2 UTSW 16 56258136 missense probably damaging 0.99
R6525:Impg2 UTSW 16 56205149 missense probably damaging 1.00
R6684:Impg2 UTSW 16 56259929 missense probably benign 0.33
R6692:Impg2 UTSW 16 56252333 missense probably damaging 1.00
R6711:Impg2 UTSW 16 56265086 missense probably damaging 1.00
R6909:Impg2 UTSW 16 56204584 missense probably damaging 0.97
R6959:Impg2 UTSW 16 56268330 missense probably benign 0.01
R7226:Impg2 UTSW 16 56267104 nonsense probably null
R7456:Impg2 UTSW 16 56259913 missense probably benign 0.03
R7528:Impg2 UTSW 16 56260380 missense possibly damaging 0.86
R7532:Impg2 UTSW 16 56267180 missense probably damaging 0.96
R7601:Impg2 UTSW 16 56260031 missense probably benign 0.22
R7803:Impg2 UTSW 16 56267150 missense probably damaging 0.99
R8063:Impg2 UTSW 16 56261456 intron probably benign
R8251:Impg2 UTSW 16 56259597 missense possibly damaging 0.92
R8292:Impg2 UTSW 16 56260626 missense probably damaging 1.00
X0023:Impg2 UTSW 16 56259876 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGAGTGACCACACAGGTTTTCAGTC -3'
(R):5'- ACGATCCAGAAGTCCTTCCCTCAG -3'

Sequencing Primer
(F):5'- ccctatcccctcccccc -3'
(R):5'- AAGTCCTTCCCTCAGGAGCC -3'
Posted On2013-08-06