Incidental Mutation 'BB020:Tapbpl'
ID643120
Institutional Source Beutler Lab
Gene Symbol Tapbpl
Ensembl Gene ENSMUSG00000038213
Gene NameTAP binding protein-like
SynonymsTAPBPL-R
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #BB020
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location125223933-125231860 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 125230270 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 152 (Q152P)
Ref Sequence ENSEMBL: ENSMUSP00000047105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032486] [ENSMUST00000043422] [ENSMUST00000063588] [ENSMUST00000112281] [ENSMUST00000112282]
Predicted Effect probably benign
Transcript: ENSMUST00000032486
SMART Domains Protein: ENSMUSP00000032486
Gene: ENSMUSG00000030336

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TNFR 27 62 1.11e-2 SMART
TNFR 65 104 1.23e-4 SMART
low complexity region 131 147 N/A INTRINSIC
transmembrane domain 183 202 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000043422
AA Change: Q152P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000047105
Gene: ENSMUSG00000038213
AA Change: Q152P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 202 306 1.11e-5 SMART
IGc1 321 397 3.97e-7 SMART
transmembrane domain 412 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063588
SMART Domains Protein: ENSMUSP00000063466
Gene: ENSMUSG00000030337

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
Pfam:Synaptobrevin 30 118 5.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112281
SMART Domains Protein: ENSMUSP00000107900
Gene: ENSMUSG00000030336

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TNFR 27 62 1.11e-2 SMART
Blast:TNFR 65 100 4e-10 BLAST
transmembrane domain 120 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112282
SMART Domains Protein: ENSMUSP00000107901
Gene: ENSMUSG00000030336

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:TNFR 27 45 1e-6 BLAST
transmembrane domain 76 98 N/A INTRINSIC
Meta Mutation Damage Score 0.3215 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tapasin, or TAPBP (MIM 601962), is a member of the variable-constant Ig superfamily that links major histocompatibility complex (MHC) class I molecules to the transporter associated with antigen processing (TAP; see MIM 170260) in the endoplasmic reticulum (ER). The TAPBP gene is located near the MHC complex on chromosome 6p21.3. TAPBPL is a member of the Ig superfamily that is localized on chromosome 12p13.3, a region somewhat paralogous to the MHC.[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,751 L85P probably damaging Het
4933414I15Rik A G 11: 50,942,400 V125A unknown Het
Adam34 T A 8: 43,650,874 H578L probably damaging Het
Ago4 A T 4: 126,507,018 M678K probably benign Het
Atrn T C 2: 130,995,066 L1150P probably damaging Het
Camta1 C T 4: 151,083,757 E279K probably damaging Het
Ccdc88c T C 12: 100,945,490 D695G possibly damaging Het
Col11a2 A T 17: 34,056,055 K400* probably null Het
Cpsf4 T A 5: 145,167,358 M1K probably null Het
Dnah12 A T 14: 26,766,115 Q992L probably benign Het
Dnajc7 T C 11: 100,596,212 Y145C probably damaging Het
Eml5 A T 12: 98,844,020 D892E possibly damaging Het
Fam193a A G 5: 34,466,195 K23E possibly damaging Het
Fam214b A T 4: 43,035,919 C271S probably benign Het
Filip1 T G 9: 79,820,047 K430T possibly damaging Het
Gm5089 T C 14: 122,435,991 D106G unknown Het
Hip1 A T 5: 135,460,456 N45K probably damaging Het
Hivep2 T C 10: 14,127,837 S60P probably damaging Het
Ighv1-53 A T 12: 115,158,409 C115* probably null Het
Macf1 T C 4: 123,409,651 T353A probably benign Het
Mast3 A T 8: 70,786,635 V433E probably damaging Het
Mast4 A T 13: 102,772,563 M660K probably damaging Het
Nr2e1 T C 10: 42,563,383 Y380C probably damaging Het
Olfr1465 T A 19: 13,314,205 M27L probably benign Het
Otog A G 7: 46,310,147 D720G probably damaging Het
Slc6a1 T A 6: 114,311,898 W473R probably damaging Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Sprr3 T C 3: 92,457,208 I110V possibly damaging Het
Ston1 A G 17: 88,636,144 E326G probably benign Het
Tectb C T 19: 55,194,673 L319F possibly damaging Het
Tpp2 G A 1: 43,960,961 G413D probably damaging Het
Tpsg1 A G 17: 25,373,204 H84R probably damaging Het
Usp24 A G 4: 106,428,489 N2437S probably benign Het
Usp32 T C 11: 85,007,059 Q1152R probably damaging Het
Vmn2r6 T C 3: 64,559,803 T92A probably benign Het
Xpo7 A G 14: 70,707,348 V35A probably benign Het
Zan T A 5: 137,463,579 T1113S unknown Het
Zfp169 A G 13: 48,490,481 V390A unknown Het
Other mutations in Tapbpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03083:Tapbpl APN 6 125228228 splice site probably null
IGL03308:Tapbpl APN 6 125228179 missense possibly damaging 0.93
BB010:Tapbpl UTSW 6 125230270 missense probably damaging 1.00
R1666:Tapbpl UTSW 6 125230201 missense probably benign 0.00
R3707:Tapbpl UTSW 6 125224695 splice site probably null
R4521:Tapbpl UTSW 6 125228122 missense probably damaging 1.00
R4744:Tapbpl UTSW 6 125228285 missense probably damaging 1.00
R6290:Tapbpl UTSW 6 125230716 missense probably benign 0.00
R6328:Tapbpl UTSW 6 125224918 missense probably benign 0.40
R6565:Tapbpl UTSW 6 125228344 missense probably benign 0.00
R7085:Tapbpl UTSW 6 125226488 splice site probably null
R7251:Tapbpl UTSW 6 125226595 missense probably damaging 0.98
R7933:Tapbpl UTSW 6 125230270 missense probably damaging 1.00
R8230:Tapbpl UTSW 6 125226721 missense probably damaging 1.00
R8920:Tapbpl UTSW 6 125228251 missense probably damaging 1.00
X0026:Tapbpl UTSW 6 125230570 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCTTGCTCGAATAAGGATCTCC -3'
(R):5'- TCTGGCGTTGTCCATCCAAC -3'

Sequencing Primer
(F):5'- CACATGGTAGGTTCTATAAGCTGTCC -3'
(R):5'- GGCGTTGTCCATCCAACATTAC -3'
Posted On2020-08-01