Incidental Mutation 'BB020:Mast3'
ID 643123
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Name microtubule associated serine/threonine kinase 3
Synonyms
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # BB020
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 71230761-71257681 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 71239279 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 433 (V433E)
Ref Sequence ENSEMBL: ENSMUSP00000148686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212001] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212673] [ENSMUST00000212757] [ENSMUST00000212875]
AlphaFold Q3U214
Predicted Effect probably damaging
Transcript: ENSMUST00000166004
AA Change: V449E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: V449E

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211948
AA Change: V433E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000212001
Predicted Effect probably benign
Transcript: ENSMUST00000212038
Predicted Effect probably benign
Transcript: ENSMUST00000212140
Predicted Effect probably benign
Transcript: ENSMUST00000212551
Predicted Effect probably benign
Transcript: ENSMUST00000212673
Predicted Effect probably benign
Transcript: ENSMUST00000212757
Predicted Effect probably benign
Transcript: ENSMUST00000212875
Meta Mutation Damage Score 0.9564 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik A G 11: 50,833,227 (GRCm39) V125A unknown Het
Adam34 T A 8: 44,103,911 (GRCm39) H578L probably damaging Het
Ago4 A T 4: 126,400,811 (GRCm39) M678K probably benign Het
Atosb A T 4: 43,035,919 (GRCm39) C271S probably benign Het
Atrn T C 2: 130,836,986 (GRCm39) L1150P probably damaging Het
Camta1 C T 4: 151,168,214 (GRCm39) E279K probably damaging Het
Ccdc88c T C 12: 100,911,749 (GRCm39) D695G possibly damaging Het
Col11a2 A T 17: 34,275,029 (GRCm39) K400* probably null Het
Cpsf4 T A 5: 145,104,168 (GRCm39) M1K probably null Het
Dnah12 A T 14: 26,488,072 (GRCm39) Q992L probably benign Het
Dnajc7 T C 11: 100,487,038 (GRCm39) Y145C probably damaging Het
Eml5 A T 12: 98,810,279 (GRCm39) D892E possibly damaging Het
Fam193a A G 5: 34,623,539 (GRCm39) K23E possibly damaging Het
Filip1 T G 9: 79,727,329 (GRCm39) K430T possibly damaging Het
Gm5089 T C 14: 122,673,403 (GRCm39) D106G unknown Het
Hip1 A T 5: 135,489,310 (GRCm39) N45K probably damaging Het
Hivep2 T C 10: 14,003,581 (GRCm39) S60P probably damaging Het
Ighv1-53 A T 12: 115,122,029 (GRCm39) C115* probably null Het
Macf1 T C 4: 123,303,444 (GRCm39) T353A probably benign Het
Mast4 A T 13: 102,909,071 (GRCm39) M660K probably damaging Het
Nr2e1 T C 10: 42,439,379 (GRCm39) Y380C probably damaging Het
Or5b111 T A 19: 13,291,569 (GRCm39) M27L probably benign Het
Otog A G 7: 45,959,571 (GRCm39) D720G probably damaging Het
Slc6a1 T A 6: 114,288,859 (GRCm39) W473R probably damaging Het
Smpd3 A C 8: 106,982,254 (GRCm39) C617G probably benign Het
Spata31d1e A G 13: 59,891,565 (GRCm39) L85P probably damaging Het
Sprr3 T C 3: 92,364,515 (GRCm39) I110V possibly damaging Het
Ston1 A G 17: 88,943,572 (GRCm39) E326G probably benign Het
Tapbpl T G 6: 125,207,233 (GRCm39) Q152P probably damaging Het
Tectb C T 19: 55,183,105 (GRCm39) L319F possibly damaging Het
Tpp2 G A 1: 44,000,121 (GRCm39) G413D probably damaging Het
Tpsg1 A G 17: 25,592,178 (GRCm39) H84R probably damaging Het
Usp24 A G 4: 106,285,686 (GRCm39) N2437S probably benign Het
Usp32 T C 11: 84,897,885 (GRCm39) Q1152R probably damaging Het
Vmn2r6 T C 3: 64,467,224 (GRCm39) T92A probably benign Het
Xpo7 A G 14: 70,944,788 (GRCm39) V35A probably benign Het
Zan T A 5: 137,461,841 (GRCm39) T1113S unknown Het
Zfp169 A G 13: 48,643,957 (GRCm39) V390A unknown Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 71,233,327 (GRCm39) splice site probably benign
IGL01411:Mast3 APN 8 71,232,227 (GRCm39) missense possibly damaging 0.50
IGL01475:Mast3 APN 8 71,232,174 (GRCm39) missense probably damaging 1.00
IGL01886:Mast3 APN 8 71,234,783 (GRCm39) missense possibly damaging 0.94
IGL02104:Mast3 APN 8 71,240,550 (GRCm39) missense possibly damaging 0.78
IGL02236:Mast3 APN 8 71,241,888 (GRCm39) missense probably benign 0.36
IGL02437:Mast3 APN 8 71,233,202 (GRCm39) missense possibly damaging 0.79
IGL02704:Mast3 APN 8 71,239,519 (GRCm39) missense probably damaging 1.00
IGL03155:Mast3 APN 8 71,241,861 (GRCm39) missense probably damaging 1.00
IGL03366:Mast3 APN 8 71,234,207 (GRCm39) nonsense probably null
gravy UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
stuffing UTSW 8 71,237,441 (GRCm39) frame shift probably null
turkey UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
BB010:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R0037:Mast3 UTSW 8 71,236,343 (GRCm39) critical splice donor site probably null
R0280:Mast3 UTSW 8 71,240,564 (GRCm39) missense possibly damaging 0.65
R0280:Mast3 UTSW 8 71,236,439 (GRCm39) missense probably damaging 1.00
R0731:Mast3 UTSW 8 71,233,965 (GRCm39) missense probably damaging 1.00
R1101:Mast3 UTSW 8 71,239,307 (GRCm39) missense probably damaging 1.00
R1177:Mast3 UTSW 8 71,232,968 (GRCm39) missense probably damaging 1.00
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1333:Mast3 UTSW 8 71,233,938 (GRCm39) missense probably damaging 1.00
R1543:Mast3 UTSW 8 71,244,955 (GRCm39) missense possibly damaging 0.93
R1544:Mast3 UTSW 8 71,238,816 (GRCm39) missense probably damaging 1.00
R1738:Mast3 UTSW 8 71,237,200 (GRCm39) missense probably benign 0.38
R1842:Mast3 UTSW 8 71,233,037 (GRCm39) missense possibly damaging 0.91
R1936:Mast3 UTSW 8 71,237,444 (GRCm39) missense probably damaging 1.00
R2015:Mast3 UTSW 8 71,240,007 (GRCm39) missense probably benign 0.00
R2219:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R2220:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R3711:Mast3 UTSW 8 71,232,251 (GRCm39) missense probably benign 0.13
R3919:Mast3 UTSW 8 71,232,066 (GRCm39) missense probably benign 0.02
R4027:Mast3 UTSW 8 71,240,552 (GRCm39) missense probably damaging 1.00
R4060:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4061:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4062:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4063:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4588:Mast3 UTSW 8 71,233,251 (GRCm39) nonsense probably null
R4672:Mast3 UTSW 8 71,237,441 (GRCm39) frame shift probably null
R4770:Mast3 UTSW 8 71,238,864 (GRCm39) missense probably damaging 1.00
R4822:Mast3 UTSW 8 71,233,010 (GRCm39) missense probably damaging 1.00
R4830:Mast3 UTSW 8 71,241,559 (GRCm39) missense possibly damaging 0.87
R5196:Mast3 UTSW 8 71,240,889 (GRCm39) missense probably damaging 1.00
R5333:Mast3 UTSW 8 71,236,145 (GRCm39) missense probably benign 0.03
R5428:Mast3 UTSW 8 71,237,377 (GRCm39) missense possibly damaging 0.95
R5656:Mast3 UTSW 8 71,238,865 (GRCm39) missense probably damaging 1.00
R5920:Mast3 UTSW 8 71,240,577 (GRCm39) missense probably benign 0.00
R6177:Mast3 UTSW 8 71,242,662 (GRCm39) missense probably damaging 1.00
R6186:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
R6407:Mast3 UTSW 8 71,234,772 (GRCm39) missense probably benign 0.02
R6614:Mast3 UTSW 8 71,234,610 (GRCm39) missense possibly damaging 0.95
R6804:Mast3 UTSW 8 71,239,376 (GRCm39) missense probably benign 0.29
R6873:Mast3 UTSW 8 71,239,236 (GRCm39) nonsense probably null
R6930:Mast3 UTSW 8 71,252,115 (GRCm39) nonsense probably null
R6948:Mast3 UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
R7084:Mast3 UTSW 8 71,232,117 (GRCm39) missense probably benign 0.14
R7253:Mast3 UTSW 8 71,242,326 (GRCm39) critical splice donor site probably null
R7316:Mast3 UTSW 8 71,232,432 (GRCm39) missense probably damaging 1.00
R7357:Mast3 UTSW 8 71,237,503 (GRCm39) missense probably damaging 1.00
R7405:Mast3 UTSW 8 71,238,815 (GRCm39) missense probably damaging 1.00
R7429:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7430:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7521:Mast3 UTSW 8 71,241,412 (GRCm39) missense probably benign 0.16
R7576:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R7933:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R7998:Mast3 UTSW 8 71,236,214 (GRCm39) missense probably benign
R8021:Mast3 UTSW 8 71,240,896 (GRCm39) missense probably benign 0.02
R8204:Mast3 UTSW 8 71,240,925 (GRCm39) missense probably benign 0.00
R8327:Mast3 UTSW 8 71,232,062 (GRCm39) missense probably damaging 1.00
R8357:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8415:Mast3 UTSW 8 71,233,866 (GRCm39) missense probably damaging 1.00
R8457:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8530:Mast3 UTSW 8 71,240,877 (GRCm39) missense possibly damaging 0.92
R8891:Mast3 UTSW 8 71,233,801 (GRCm39) missense probably damaging 1.00
R8930:Mast3 UTSW 8 71,234,377 (GRCm39) splice site probably benign
R9002:Mast3 UTSW 8 71,233,904 (GRCm39) missense probably damaging 1.00
R9085:Mast3 UTSW 8 71,249,361 (GRCm39) missense unknown
R9087:Mast3 UTSW 8 71,242,330 (GRCm39) missense possibly damaging 0.93
R9148:Mast3 UTSW 8 71,233,091 (GRCm39) missense probably damaging 0.98
R9364:Mast3 UTSW 8 71,238,826 (GRCm39) missense probably damaging 1.00
R9779:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
Z1177:Mast3 UTSW 8 71,241,682 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TATTTCCCTTGCACGGTGG -3'
(R):5'- CAATGGAGCCTATGGGTGAGTC -3'

Sequencing Primer
(F):5'- GTGGCCGTCTCACCTGC -3'
(R):5'- TGGACTTGGAGTAATGGCTAC -3'
Posted On 2020-08-01