Incidental Mutation 'BB020:Smpd3'
ID643124
Institutional Source Beutler Lab
Gene Symbol Smpd3
Ensembl Gene ENSMUSG00000031906
Gene Namesphingomyelin phosphodiesterase 3, neutral
Synonymsneutral sphingomyelinase II, nSMase2, fro, 4631433G07Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #BB020
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location106252548-106337988 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 106255622 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 617 (C617G)
Ref Sequence ENSEMBL: ENSMUSP00000148282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067512] [ENSMUST00000071592] [ENSMUST00000212896]
Predicted Effect probably benign
Transcript: ENSMUST00000067512
AA Change: C617G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069255
Gene: ENSMUSG00000031906
AA Change: C617G

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
Pfam:Exo_endo_phos 321 639 1.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071592
SMART Domains Protein: ENSMUSP00000071521
Gene: ENSMUSG00000060098

DomainStartEndE-ValueType
Pfam:PrmA 53 148 1.6e-7 PFAM
internal_repeat_1 382 652 1.71e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000212896
AA Change: C617G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit dwarfism, delayed sexual and gonad maturation, delayed ossification of the long bones, and reduced serum levels of thyroxine, triiodothyronine, cortisol, and insulin-like growth factor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,751 L85P probably damaging Het
4933414I15Rik A G 11: 50,942,400 V125A unknown Het
Adam34 T A 8: 43,650,874 H578L probably damaging Het
Ago4 A T 4: 126,507,018 M678K probably benign Het
Atrn T C 2: 130,995,066 L1150P probably damaging Het
Camta1 C T 4: 151,083,757 E279K probably damaging Het
Ccdc88c T C 12: 100,945,490 D695G possibly damaging Het
Col11a2 A T 17: 34,056,055 K400* probably null Het
Cpsf4 T A 5: 145,167,358 M1K probably null Het
Dnah12 A T 14: 26,766,115 Q992L probably benign Het
Dnajc7 T C 11: 100,596,212 Y145C probably damaging Het
Eml5 A T 12: 98,844,020 D892E possibly damaging Het
Fam193a A G 5: 34,466,195 K23E possibly damaging Het
Fam214b A T 4: 43,035,919 C271S probably benign Het
Filip1 T G 9: 79,820,047 K430T possibly damaging Het
Gm5089 T C 14: 122,435,991 D106G unknown Het
Hip1 A T 5: 135,460,456 N45K probably damaging Het
Hivep2 T C 10: 14,127,837 S60P probably damaging Het
Ighv1-53 A T 12: 115,158,409 C115* probably null Het
Macf1 T C 4: 123,409,651 T353A probably benign Het
Mast3 A T 8: 70,786,635 V433E probably damaging Het
Mast4 A T 13: 102,772,563 M660K probably damaging Het
Nr2e1 T C 10: 42,563,383 Y380C probably damaging Het
Olfr1465 T A 19: 13,314,205 M27L probably benign Het
Otog A G 7: 46,310,147 D720G probably damaging Het
Slc6a1 T A 6: 114,311,898 W473R probably damaging Het
Sprr3 T C 3: 92,457,208 I110V possibly damaging Het
Ston1 A G 17: 88,636,144 E326G probably benign Het
Tapbpl T G 6: 125,230,270 Q152P probably damaging Het
Tectb C T 19: 55,194,673 L319F possibly damaging Het
Tpp2 G A 1: 43,960,961 G413D probably damaging Het
Tpsg1 A G 17: 25,373,204 H84R probably damaging Het
Usp24 A G 4: 106,428,489 N2437S probably benign Het
Usp32 T C 11: 85,007,059 Q1152R probably damaging Het
Vmn2r6 T C 3: 64,559,803 T92A probably benign Het
Xpo7 A G 14: 70,707,348 V35A probably benign Het
Zan T A 5: 137,463,579 T1113S unknown Het
Zfp169 A G 13: 48,490,481 V390A unknown Het
Other mutations in Smpd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03380:Smpd3 APN 8 106259659 missense probably benign 0.01
BB010:Smpd3 UTSW 8 106255622 missense probably benign
G1citation:Smpd3 UTSW 8 106265964 start gained probably benign
R0240:Smpd3 UTSW 8 106265156 missense probably damaging 0.96
R0240:Smpd3 UTSW 8 106265156 missense probably damaging 0.96
R0456:Smpd3 UTSW 8 106259656 missense probably benign
R0759:Smpd3 UTSW 8 106265228 missense probably benign 0.34
R0799:Smpd3 UTSW 8 106264789 missense possibly damaging 0.92
R1544:Smpd3 UTSW 8 106265567 missense possibly damaging 0.70
R1756:Smpd3 UTSW 8 106264971 missense probably benign
R2937:Smpd3 UTSW 8 106264820 missense probably damaging 1.00
R2939:Smpd3 UTSW 8 106257407 missense probably benign 0.00
R4614:Smpd3 UTSW 8 106259739 missense probably damaging 1.00
R5829:Smpd3 UTSW 8 106264880 missense probably benign 0.15
R6822:Smpd3 UTSW 8 106265964 start gained probably benign
R6891:Smpd3 UTSW 8 106264668 missense probably damaging 1.00
R6962:Smpd3 UTSW 8 106265219 missense probably benign 0.34
R6965:Smpd3 UTSW 8 106259881 missense probably damaging 1.00
R7344:Smpd3 UTSW 8 106265193 missense probably damaging 1.00
R7394:Smpd3 UTSW 8 106265010 missense probably damaging 0.99
R7823:Smpd3 UTSW 8 106255622 missense probably benign
R7825:Smpd3 UTSW 8 106255622 missense probably benign
R7933:Smpd3 UTSW 8 106255622 missense probably benign
R7974:Smpd3 UTSW 8 106255622 missense probably benign
R7975:Smpd3 UTSW 8 106255622 missense probably benign
R7976:Smpd3 UTSW 8 106255622 missense probably benign
R7977:Smpd3 UTSW 8 106259894 missense probably benign 0.11
R7987:Smpd3 UTSW 8 106259894 missense probably benign 0.11
R8260:Smpd3 UTSW 8 106257415 missense probably benign 0.13
R8264:Smpd3 UTSW 8 106264658 missense probably damaging 1.00
R8292:Smpd3 UTSW 8 106264790 missense probably benign 0.08
R8432:Smpd3 UTSW 8 106257677 critical splice acceptor site probably null
R8494:Smpd3 UTSW 8 106255350 missense probably damaging 0.99
R8779:Smpd3 UTSW 8 106265489 missense probably benign 0.37
R8787:Smpd3 UTSW 8 106255745 missense probably damaging 1.00
Z1177:Smpd3 UTSW 8 106264842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGCTCCAAAGAGAAGTGCTC -3'
(R):5'- GCACAGAACTTTAGCTTGTTTCCC -3'

Sequencing Primer
(F):5'- CTCTGTGAAGGGGAGTGCC -3'
(R):5'- AGAACTTTAGCTTGTTTCCCTTCTG -3'
Posted On2020-08-01