Incidental Mutation 'BB020:Nr2e1'
ID 643127
Institutional Source Beutler Lab
Gene Symbol Nr2e1
Ensembl Gene ENSMUSG00000019803
Gene Name nuclear receptor subfamily 2, group E, member 1
Synonyms tailless, Mtll, Tlx, Nr2e1
Accession Numbers
Essential gene? Probably essential (E-score: 0.885) question?
Stock # BB020
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 42437959-42459628 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 42439379 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 380 (Y380C)
Ref Sequence ENSEMBL: ENSMUSP00000019938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019938] [ENSMUST00000105498]
AlphaFold Q64104
Predicted Effect probably damaging
Transcript: ENSMUST00000019938
AA Change: Y380C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019938
Gene: ENSMUSG00000019803
AA Change: Y380C

DomainStartEndE-ValueType
ZnF_C4 13 86 2.04e-36 SMART
HOLI 187 354 1.42e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105498
AA Change: Y168C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101137
Gene: ENSMUSG00000019803
AA Change: Y168C

DomainStartEndE-ValueType
HOLI 3 142 2.56e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an orphan receptor involved in retinal development. The encoded protein also regulates adult neural stem cell proliferation and may be involved in control of aggressive behavior. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes have small brains, hypoplasia of cerebrum and olfactory lobes, thin optic layers, reduced retinal vessels and hydrocephaly on some genetic backgrounds. Mutants do poorly in sensorimotor tests, are aggressive and females lack maternal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik A G 11: 50,833,227 (GRCm39) V125A unknown Het
Adam34 T A 8: 44,103,911 (GRCm39) H578L probably damaging Het
Ago4 A T 4: 126,400,811 (GRCm39) M678K probably benign Het
Atosb A T 4: 43,035,919 (GRCm39) C271S probably benign Het
Atrn T C 2: 130,836,986 (GRCm39) L1150P probably damaging Het
Camta1 C T 4: 151,168,214 (GRCm39) E279K probably damaging Het
Ccdc88c T C 12: 100,911,749 (GRCm39) D695G possibly damaging Het
Col11a2 A T 17: 34,275,029 (GRCm39) K400* probably null Het
Cpsf4 T A 5: 145,104,168 (GRCm39) M1K probably null Het
Dnah12 A T 14: 26,488,072 (GRCm39) Q992L probably benign Het
Dnajc7 T C 11: 100,487,038 (GRCm39) Y145C probably damaging Het
Eml5 A T 12: 98,810,279 (GRCm39) D892E possibly damaging Het
Fam193a A G 5: 34,623,539 (GRCm39) K23E possibly damaging Het
Filip1 T G 9: 79,727,329 (GRCm39) K430T possibly damaging Het
Gm5089 T C 14: 122,673,403 (GRCm39) D106G unknown Het
Hip1 A T 5: 135,489,310 (GRCm39) N45K probably damaging Het
Hivep2 T C 10: 14,003,581 (GRCm39) S60P probably damaging Het
Ighv1-53 A T 12: 115,122,029 (GRCm39) C115* probably null Het
Macf1 T C 4: 123,303,444 (GRCm39) T353A probably benign Het
Mast3 A T 8: 71,239,279 (GRCm39) V433E probably damaging Het
Mast4 A T 13: 102,909,071 (GRCm39) M660K probably damaging Het
Or5b111 T A 19: 13,291,569 (GRCm39) M27L probably benign Het
Otog A G 7: 45,959,571 (GRCm39) D720G probably damaging Het
Slc6a1 T A 6: 114,288,859 (GRCm39) W473R probably damaging Het
Smpd3 A C 8: 106,982,254 (GRCm39) C617G probably benign Het
Spata31d1e A G 13: 59,891,565 (GRCm39) L85P probably damaging Het
Sprr3 T C 3: 92,364,515 (GRCm39) I110V possibly damaging Het
Ston1 A G 17: 88,943,572 (GRCm39) E326G probably benign Het
Tapbpl T G 6: 125,207,233 (GRCm39) Q152P probably damaging Het
Tectb C T 19: 55,183,105 (GRCm39) L319F possibly damaging Het
Tpp2 G A 1: 44,000,121 (GRCm39) G413D probably damaging Het
Tpsg1 A G 17: 25,592,178 (GRCm39) H84R probably damaging Het
Usp24 A G 4: 106,285,686 (GRCm39) N2437S probably benign Het
Usp32 T C 11: 84,897,885 (GRCm39) Q1152R probably damaging Het
Vmn2r6 T C 3: 64,467,224 (GRCm39) T92A probably benign Het
Xpo7 A G 14: 70,944,788 (GRCm39) V35A probably benign Het
Zan T A 5: 137,461,841 (GRCm39) T1113S unknown Het
Zfp169 A G 13: 48,643,957 (GRCm39) V390A unknown Het
Other mutations in Nr2e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Nr2e1 APN 10 42,444,449 (GRCm39) missense probably damaging 1.00
IGL01936:Nr2e1 APN 10 42,443,969 (GRCm39) missense possibly damaging 0.90
IGL02272:Nr2e1 APN 10 42,443,975 (GRCm39) missense probably damaging 1.00
IGL03092:Nr2e1 APN 10 42,447,478 (GRCm39) missense probably damaging 1.00
IGL03405:Nr2e1 APN 10 42,444,377 (GRCm39) missense probably damaging 1.00
Dubious UTSW 10 42,447,483 (GRCm39) nonsense probably null
BB010:Nr2e1 UTSW 10 42,439,379 (GRCm39) missense probably damaging 1.00
R1581:Nr2e1 UTSW 10 42,443,964 (GRCm39) missense probably benign 0.12
R1807:Nr2e1 UTSW 10 42,458,905 (GRCm39) splice site probably null
R1879:Nr2e1 UTSW 10 42,444,367 (GRCm39) critical splice donor site probably null
R1944:Nr2e1 UTSW 10 42,448,774 (GRCm39) missense probably benign
R2426:Nr2e1 UTSW 10 42,439,481 (GRCm39) missense probably damaging 1.00
R2842:Nr2e1 UTSW 10 42,444,441 (GRCm39) missense probably damaging 0.99
R4515:Nr2e1 UTSW 10 42,454,187 (GRCm39) missense probably benign
R5305:Nr2e1 UTSW 10 42,447,483 (GRCm39) nonsense probably null
R5316:Nr2e1 UTSW 10 42,447,487 (GRCm39) missense probably benign 0.10
R5325:Nr2e1 UTSW 10 42,448,780 (GRCm39) missense probably damaging 1.00
R5908:Nr2e1 UTSW 10 42,448,765 (GRCm39) missense probably benign
R7040:Nr2e1 UTSW 10 42,444,374 (GRCm39) missense probably damaging 0.99
R7593:Nr2e1 UTSW 10 42,439,475 (GRCm39) missense probably damaging 1.00
R7765:Nr2e1 UTSW 10 42,450,433 (GRCm39) missense probably benign 0.32
R7933:Nr2e1 UTSW 10 42,439,379 (GRCm39) missense probably damaging 1.00
R8158:Nr2e1 UTSW 10 42,458,881 (GRCm39) missense probably benign 0.00
R8342:Nr2e1 UTSW 10 42,444,425 (GRCm39) missense probably damaging 1.00
R8916:Nr2e1 UTSW 10 42,443,864 (GRCm39) missense possibly damaging 0.94
R9145:Nr2e1 UTSW 10 42,448,948 (GRCm39) missense probably benign 0.02
R9189:Nr2e1 UTSW 10 42,454,268 (GRCm39) missense probably damaging 0.99
R9381:Nr2e1 UTSW 10 42,439,468 (GRCm39) missense probably damaging 1.00
R9499:Nr2e1 UTSW 10 42,447,487 (GRCm39) missense probably benign 0.10
R9552:Nr2e1 UTSW 10 42,447,487 (GRCm39) missense probably benign 0.10
Z1177:Nr2e1 UTSW 10 42,444,423 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGTTGTAACCACCTGGC -3'
(R):5'- GGCCCTGACATCAATTTCCTG -3'

Sequencing Primer
(F):5'- ACAGCAGGTCATAGCTGTTG -3'
(R):5'- GCCTTCTCCTATTGCAGATACC -3'
Posted On 2020-08-01