Incidental Mutation 'R0051:Dcp2'
ID64313
Institutional Source Beutler Lab
Gene Symbol Dcp2
Ensembl Gene ENSMUSG00000024472
Gene Namedecapping mRNA 2
Synonyms
MMRRC Submission 038345-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R0051 (G1)
Quality Score189
Status Validated
Chromosome18
Chromosomal Location44380502-44424969 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 44405374 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025350]
Predicted Effect probably benign
Transcript: ENSMUST00000025350
SMART Domains Protein: ENSMUSP00000025350
Gene: ENSMUSG00000024472

DomainStartEndE-ValueType
DCP2 10 94 4.23e-50 SMART
Pfam:NUDIX 97 219 6.5e-17 PFAM
low complexity region 240 258 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a key component of an mRNA-decapping complex required for degradation of mRNAs, both in normal mRNA turnover, and in nonsense-mediated mRNA decay (NMD). It removes the 7-methyl guanine cap structure from mRNA, prior to its degradation from the 5' end. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,579,101 noncoding transcript Het
Abr T A 11: 76,472,502 Q163L probably benign Het
AI314180 A G 4: 58,832,729 L877S probably damaging Het
Ankrd11 C A 8: 122,889,742 C2457F probably damaging Het
Anks3 G C 16: 4,947,749 T163S probably benign Het
Cacna1d G A 14: 30,111,095 P908S probably damaging Het
Ccdc146 C A 5: 21,316,904 R374L possibly damaging Het
Cdc45 G T 16: 18,794,774 A348E probably damaging Het
Cfap46 A G 7: 139,676,035 C300R probably damaging Het
Coq2 T C 5: 100,663,685 N146S probably benign Het
Dalrd3 T C 9: 108,572,215 V120A possibly damaging Het
Ddx39 A G 8: 83,720,622 K137R possibly damaging Het
Diaph3 A G 14: 87,037,454 probably null Het
Dmbt1 G T 7: 131,119,496 R1668L possibly damaging Het
Dnah7a T G 1: 53,521,086 probably benign Het
Dpp7 A G 2: 25,356,095 Y49H possibly damaging Het
Drd5 A G 5: 38,320,614 S317G probably benign Het
Ecsit C T 9: 22,076,288 V152I probably benign Het
Emc1 T A 4: 139,375,163 M923K possibly damaging Het
Fam102a G A 2: 32,558,053 R58Q possibly damaging Het
Fcrl6 A T 1: 172,598,753 L159Q probably benign Het
Frrs1 T C 3: 116,885,297 probably benign Het
Hspd1 A G 1: 55,082,046 probably benign Het
Impg2 T A 16: 56,258,048 S458T probably damaging Het
Klf17 T C 4: 117,760,392 Y256C probably damaging Het
Lnx2 A G 5: 147,029,353 F319L probably damaging Het
Mafg G T 11: 120,629,604 R57S probably damaging Het
Med13l T A 5: 118,742,655 W1271R probably damaging Het
Mrgprb1 A G 7: 48,447,214 S24P probably benign Het
Mtrf1l T C 10: 5,813,384 E315G probably damaging Het
Naip1 T C 13: 100,411,001 E1239G probably damaging Het
Ncaph2 T C 15: 89,369,664 S320P probably damaging Het
Nek11 A G 9: 105,218,539 probably benign Het
Nlrp2 A T 7: 5,322,334 probably benign Het
Odf3 C A 7: 140,850,221 probably benign Het
Rbm26 A C 14: 105,152,540 V216G possibly damaging Het
Rnf115 A G 3: 96,785,022 D178G probably damaging Het
Rtel1 C T 2: 181,350,656 Q424* probably null Het
Rwdd4a A G 8: 47,537,365 probably benign Het
Ryr3 T C 2: 112,869,075 D890G probably damaging Het
Scarb1 C A 5: 125,281,100 probably null Het
Serpina10 A G 12: 103,626,897 probably benign Het
Slc12a5 T A 2: 164,986,663 W508R probably damaging Het
Slc43a2 T C 11: 75,562,850 C225R probably damaging Het
Slc6a9 T C 4: 117,864,859 F440L probably damaging Het
Stac3 G A 10: 127,508,148 R305H probably damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Syna A T 5: 134,559,543 L184H probably damaging Het
Tmprss7 T C 16: 45,673,939 N401S probably damaging Het
Yeats2 T A 16: 20,193,724 Y557* probably null Het
Zcchc11 T G 4: 108,527,004 S1089R probably damaging Het
Zfp352 T C 4: 90,224,285 S221P probably damaging Het
Zfp575 A G 7: 24,586,087 V43A probably benign Het
Zfp775 A G 6: 48,620,772 T527A probably benign Het
Other mutations in Dcp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02801:Dcp2 APN 18 44417711 missense probably damaging 1.00
belay UTSW 18 44395952 missense probably damaging 0.99
PIT4431001:Dcp2 UTSW 18 44412571 missense probably benign 0.15
R0515:Dcp2 UTSW 18 44399731 missense probably benign 0.41
R0761:Dcp2 UTSW 18 44410233 missense probably benign 0.01
R1696:Dcp2 UTSW 18 44400324 missense probably damaging 1.00
R1803:Dcp2 UTSW 18 44395917 missense probably damaging 1.00
R1928:Dcp2 UTSW 18 44405571 critical splice donor site probably null
R1964:Dcp2 UTSW 18 44395971 missense possibly damaging 0.50
R2014:Dcp2 UTSW 18 44410296 missense probably benign 0.00
R2209:Dcp2 UTSW 18 44405514 nonsense probably null
R4167:Dcp2 UTSW 18 44395967 missense probably damaging 1.00
R4668:Dcp2 UTSW 18 44415362 splice site probably null
R4877:Dcp2 UTSW 18 44417592 missense probably benign 0.11
R5147:Dcp2 UTSW 18 44417595 nonsense probably null
R5559:Dcp2 UTSW 18 44405487 missense probably damaging 1.00
R6533:Dcp2 UTSW 18 44399664 missense probably benign 0.25
R7406:Dcp2 UTSW 18 44410187 missense probably benign 0.00
R7469:Dcp2 UTSW 18 44395952 missense probably damaging 0.99
R7850:Dcp2 UTSW 18 44400348 nonsense probably null
R8054:Dcp2 UTSW 18 44405707 missense probably benign 0.02
R8315:Dcp2 UTSW 18 44396004 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCATAAGAAGGGGCTTGGTCCTA -3'
(R):5'- GCAGCAGTGAGGCCAGTTTTACAG -3'

Sequencing Primer
(F):5'- AAGAAGGGGCTTGGTCCTAATTATC -3'
(R):5'- GGCCATAAAAAACTTATTAGGTGC -3'
Posted On2013-08-06