Mutagenetix > Incidental Mutations

Incidental Mutation 'R0051:Dcp2'

64313

Institutional Source

Beutler Lab

Gene Symbol

Dcp2

Ensembl Gene

ENSMUSG00000024472

Gene Name

decapping mRNA 2

Synonyms

MMRRC Submission

038345-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.967) question?

Stock #

R0051 (G1)

Quality Score

189

Status

Validated

Chromosome

Chromosomal Location

44380502-44424969 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 44405374 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000025350 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025350]

Predicted Effect

probably benign
Transcript: ENSMUST00000025350

SMART Domains

Protein: ENSMUSP00000025350
Gene: ENSMUSG00000024472

Domain	Start	End	E-Value	Type
DCP2	10	94	4.23e-50	SMART
Pfam:NUDIX	97	219	6.5e-17	PFAM
low complexity region	240	258	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.1%
20x: 93.8%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a key component of an mRNA-decapping complex required for degradation of mRNAs, both in normal mRNA turnover, and in nonsense-mediated mRNA decay (NMD). It removes the 7-methyl guanine cap structure from mRNA, prior to its degradation from the 5' end. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and fertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	A	G	7: 29,579,101		noncoding transcript	Het
Abr	T	A	11: 76,472,502	Q163L	probably benign	Het
AI314180	A	G	4: 58,832,729	L877S	probably damaging	Het
Ankrd11	C	A	8: 122,889,742	C2457F	probably damaging	Het
Anks3	G	C	16: 4,947,749	T163S	probably benign	Het
Cacna1d	G	A	14: 30,111,095	P908S	probably damaging	Het
Ccdc146	C	A	5: 21,316,904	R374L	possibly damaging	Het
Cdc45	G	T	16: 18,794,774	A348E	probably damaging	Het
Cfap46	A	G	7: 139,676,035	C300R	probably damaging	Het
Coq2	T	C	5: 100,663,685	N146S	probably benign	Het
Dalrd3	T	C	9: 108,572,215	V120A	possibly damaging	Het
Ddx39	A	G	8: 83,720,622	K137R	possibly damaging	Het
Diaph3	A	G	14: 87,037,454		probably null	Het
Dmbt1	G	T	7: 131,119,496	R1668L	possibly damaging	Het
Dnah7a	T	G	1: 53,521,086		probably benign	Het
Dpp7	A	G	2: 25,356,095	Y49H	possibly damaging	Het
Drd5	A	G	5: 38,320,614	S317G	probably benign	Het
Ecsit	C	T	9: 22,076,288	V152I	probably benign	Het
Emc1	T	A	4: 139,375,163	M923K	possibly damaging	Het
Fam102a	G	A	2: 32,558,053	R58Q	possibly damaging	Het
Fcrl6	A	T	1: 172,598,753	L159Q	probably benign	Het
Frrs1	T	C	3: 116,885,297		probably benign	Het
Hspd1	A	G	1: 55,082,046		probably benign	Het
Impg2	T	A	16: 56,258,048	S458T	probably damaging	Het
Klf17	T	C	4: 117,760,392	Y256C	probably damaging	Het
Lnx2	A	G	5: 147,029,353	F319L	probably damaging	Het
Mafg	G	T	11: 120,629,604	R57S	probably damaging	Het
Med13l	T	A	5: 118,742,655	W1271R	probably damaging	Het
Mrgprb1	A	G	7: 48,447,214	S24P	probably benign	Het
Mtrf1l	T	C	10: 5,813,384	E315G	probably damaging	Het
Naip1	T	C	13: 100,411,001	E1239G	probably damaging	Het
Ncaph2	T	C	15: 89,369,664	S320P	probably damaging	Het
Nek11	A	G	9: 105,218,539		probably benign	Het
Nlrp2	A	T	7: 5,322,334		probably benign	Het
Odf3	C	A	7: 140,850,221		probably benign	Het
Rbm26	A	C	14: 105,152,540	V216G	possibly damaging	Het
Rnf115	A	G	3: 96,785,022	D178G	probably damaging	Het
Rtel1	C	T	2: 181,350,656	Q424*	probably null	Het
Rwdd4a	A	G	8: 47,537,365		probably benign	Het
Ryr3	T	C	2: 112,869,075	D890G	probably damaging	Het
Scarb1	C	A	5: 125,281,100		probably null	Het
Serpina10	A	G	12: 103,626,897		probably benign	Het
Slc12a5	T	A	2: 164,986,663	W508R	probably damaging	Het
Slc43a2	T	C	11: 75,562,850	C225R	probably damaging	Het
Slc6a9	T	C	4: 117,864,859	F440L	probably damaging	Het
Stac3	G	A	10: 127,508,148	R305H	probably damaging	Het
Stk32b	A	G	5: 37,459,596		probably benign	Het
Syna	A	T	5: 134,559,543	L184H	probably damaging	Het
Tmprss7	T	C	16: 45,673,939	N401S	probably damaging	Het
Yeats2	T	A	16: 20,193,724	Y557*	probably null	Het
Zcchc11	T	G	4: 108,527,004	S1089R	probably damaging	Het
Zfp352	T	C	4: 90,224,285	S221P	probably damaging	Het
Zfp575	A	G	7: 24,586,087	V43A	probably benign	Het
Zfp775	A	G	6: 48,620,772	T527A	probably benign	Het

Other mutations in Dcp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02801:Dcp2	APN	18	44417711	missense	probably damaging	1.00
belay	UTSW	18	44395952	missense	probably damaging	0.99
PIT4431001:Dcp2	UTSW	18	44412571	missense	probably benign	0.15
R0515:Dcp2	UTSW	18	44399731	missense	probably benign	0.41
R0761:Dcp2	UTSW	18	44410233	missense	probably benign	0.01
R1696:Dcp2	UTSW	18	44400324	missense	probably damaging	1.00
R1803:Dcp2	UTSW	18	44395917	missense	probably damaging	1.00
R1928:Dcp2	UTSW	18	44405571	critical splice donor site	probably null
R1964:Dcp2	UTSW	18	44395971	missense	possibly damaging	0.50
R2014:Dcp2	UTSW	18	44410296	missense	probably benign	0.00
R2209:Dcp2	UTSW	18	44405514	nonsense	probably null
R4167:Dcp2	UTSW	18	44395967	missense	probably damaging	1.00
R4668:Dcp2	UTSW	18	44415362	splice site	probably null
R4877:Dcp2	UTSW	18	44417592	missense	probably benign	0.11
R5147:Dcp2	UTSW	18	44417595	nonsense	probably null
R5559:Dcp2	UTSW	18	44405487	missense	probably damaging	1.00
R6533:Dcp2	UTSW	18	44399664	missense	probably benign	0.25
R7406:Dcp2	UTSW	18	44410187	missense	probably benign	0.00
R7469:Dcp2	UTSW	18	44395952	missense	probably damaging	0.99
R7850:Dcp2	UTSW	18	44400348	nonsense	probably null
R8054:Dcp2	UTSW	18	44405707	missense	probably benign	0.02
R8315:Dcp2	UTSW	18	44396004	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGCATAAGAAGGGGCTTGGTCCTA -3'
(R):5'- GCAGCAGTGAGGCCAGTTTTACAG -3'

Sequencing Primer
(F):5'- AAGAAGGGGCTTGGTCCTAATTATC -3'
(R):5'- GGCCATAAAAAACTTATTAGGTGC -3'

Posted On

2013-08-06