Incidental Mutation 'BB020:Dnajc7'
ID643130
Institutional Source Beutler Lab
Gene Symbol Dnajc7
Ensembl Gene ENSMUSG00000014195
Gene NameDnaJ heat shock protein family (Hsp40) member C7
SynonymsmTpr2, Ttc2, 2010003F24Rik, mDj11, 2010004G07Rik
Accession Numbers

Genbank: NM_019795; MGI: 1928373

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #BB020
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location100582818-100620168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100596212 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 145 (Y145C)
Ref Sequence ENSEMBL: ENSMUSP00000014339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014339] [ENSMUST00000146840]
Predicted Effect probably damaging
Transcript: ENSMUST00000014339
AA Change: Y145C

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000014339
Gene: ENSMUSG00000014195
AA Change: Y145C

DomainStartEndE-ValueType
TPR 28 61 3.39e-7 SMART
TPR 62 95 1.11e-2 SMART
TPR 96 129 4.09e-1 SMART
Blast:TPR 142 175 4e-13 BLAST
Blast:TPR 176 209 1e-13 BLAST
TPR 210 243 2.29e-4 SMART
TPR 256 289 1.11e-2 SMART
TPR 294 327 2.87e-5 SMART
TPR 328 361 1.83e-3 SMART
DnaJ 380 443 2.93e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000146840
AA Change: Y129C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115438
Gene: ENSMUSG00000014195
AA Change: Y129C

DomainStartEndE-ValueType
TPR 12 45 3.39e-7 SMART
TPR 46 79 1.11e-2 SMART
TPR 80 113 4.09e-1 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000116793
Gene: ENSMUSG00000014195
AA Change: Y97C

DomainStartEndE-ValueType
TPR 19 52 3.39e-7 SMART
TPR 53 86 1.11e-2 SMART
Blast:TPR 95 128 1e-13 BLAST
Blast:TPR 129 162 3e-14 BLAST
TPR 163 196 2.29e-4 SMART
TPR 209 242 1.11e-2 SMART
Meta Mutation Damage Score 0.1770 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNAJ heat shock protein 40 family of proteins that is characterized by two N-terminal tetratricopeptide repeat domains and a C-terminal DNAJ domain. This protein binds the chaperone proteins heat shock proteins 70 and 90 in an ATP-dependent manner and may function as a co-chaperone. Pseudogenes of this gene are found on chromosomes 1 and 6. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2009]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit hepatic steatosis and increased serum cholesterol. [provided by MGI curators]
Allele List at MGI

All alleles(178) : Targeted, other(2) Gene trapped(176)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,751 L85P probably damaging Het
4933414I15Rik A G 11: 50,942,400 V125A unknown Het
Adam34 T A 8: 43,650,874 H578L probably damaging Het
Ago4 A T 4: 126,507,018 M678K probably benign Het
Atrn T C 2: 130,995,066 L1150P probably damaging Het
Camta1 C T 4: 151,083,757 E279K probably damaging Het
Ccdc88c T C 12: 100,945,490 D695G possibly damaging Het
Col11a2 A T 17: 34,056,055 K400* probably null Het
Cpsf4 T A 5: 145,167,358 M1K probably null Het
Dnah12 A T 14: 26,766,115 Q992L probably benign Het
Eml5 A T 12: 98,844,020 D892E possibly damaging Het
Fam193a A G 5: 34,466,195 K23E possibly damaging Het
Fam214b A T 4: 43,035,919 C271S probably benign Het
Filip1 T G 9: 79,820,047 K430T possibly damaging Het
Gm5089 T C 14: 122,435,991 D106G unknown Het
Hip1 A T 5: 135,460,456 N45K probably damaging Het
Hivep2 T C 10: 14,127,837 S60P probably damaging Het
Ighv1-53 A T 12: 115,158,409 C115* probably null Het
Macf1 T C 4: 123,409,651 T353A probably benign Het
Mast3 A T 8: 70,786,635 V433E probably damaging Het
Mast4 A T 13: 102,772,563 M660K probably damaging Het
Nr2e1 T C 10: 42,563,383 Y380C probably damaging Het
Olfr1465 T A 19: 13,314,205 M27L probably benign Het
Otog A G 7: 46,310,147 D720G probably damaging Het
Slc6a1 T A 6: 114,311,898 W473R probably damaging Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Sprr3 T C 3: 92,457,208 I110V possibly damaging Het
Ston1 A G 17: 88,636,144 E326G probably benign Het
Tapbpl T G 6: 125,230,270 Q152P probably damaging Het
Tectb C T 19: 55,194,673 L319F possibly damaging Het
Tpp2 G A 1: 43,960,961 G413D probably damaging Het
Tpsg1 A G 17: 25,373,204 H84R probably damaging Het
Usp24 A G 4: 106,428,489 N2437S probably benign Het
Usp32 T C 11: 85,007,059 Q1152R probably damaging Het
Vmn2r6 T C 3: 64,559,803 T92A probably benign Het
Xpo7 A G 14: 70,707,348 V35A probably benign Het
Zan T A 5: 137,463,579 T1113S unknown Het
Zfp169 A G 13: 48,490,481 V390A unknown Het
Other mutations in Dnajc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Dnajc7 APN 11 100599191 missense possibly damaging 0.90
IGL00924:Dnajc7 APN 11 100584285 missense possibly damaging 0.81
3-1:Dnajc7 UTSW 11 100589957 missense probably damaging 1.00
BB010:Dnajc7 UTSW 11 100596212 missense probably damaging 0.98
R1282:Dnajc7 UTSW 11 100584641 missense probably damaging 1.00
R1587:Dnajc7 UTSW 11 100601730 missense probably damaging 1.00
R1874:Dnajc7 UTSW 11 100599313 splice site probably benign
R1985:Dnajc7 UTSW 11 100590892 missense probably benign 0.11
R4020:Dnajc7 UTSW 11 100591466 missense probably damaging 0.96
R4065:Dnajc7 UTSW 11 100601781 missense probably benign 0.00
R4067:Dnajc7 UTSW 11 100601781 missense probably benign 0.00
R4611:Dnajc7 UTSW 11 100590977 nonsense probably null
R4687:Dnajc7 UTSW 11 100599300 missense probably damaging 1.00
R4716:Dnajc7 UTSW 11 100619576 missense probably benign
R7469:Dnajc7 UTSW 11 100591551 missense probably benign
R7740:Dnajc7 UTSW 11 100591561 missense probably benign 0.01
R7842:Dnajc7 UTSW 11 100598718 missense probably benign 0.42
R7886:Dnajc7 UTSW 11 100601803 missense probably benign 0.00
R7933:Dnajc7 UTSW 11 100596212 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TACCTGACATAGCCAACGGG -3'
(R):5'- GGGTTTCTAGATCAGGTCTCTATC -3'

Sequencing Primer
(F):5'- CGGGAATATAAGCAAGCTGATTTTTG -3'
(R):5'- CTGGAACTCACTATGTAGTTCAGGC -3'
Posted On2020-08-01