Incidental Mutation 'BB020:Gm5089'
ID643139
Institutional Source Beutler Lab
Gene Symbol Gm5089
Ensembl Gene ENSMUSG00000064052
Gene Namepredicted gene 5089
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #BB020
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location122434854-122451115 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122435991 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 106 (D106G)
Ref Sequence ENSEMBL: ENSMUSP00000080290 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000081580
AA Change: D106G
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,751 L85P probably damaging Het
4933414I15Rik A G 11: 50,942,400 V125A unknown Het
Adam34 T A 8: 43,650,874 H578L probably damaging Het
Ago4 A T 4: 126,507,018 M678K probably benign Het
Atrn T C 2: 130,995,066 L1150P probably damaging Het
Camta1 C T 4: 151,083,757 E279K probably damaging Het
Ccdc88c T C 12: 100,945,490 D695G possibly damaging Het
Col11a2 A T 17: 34,056,055 K400* probably null Het
Cpsf4 T A 5: 145,167,358 M1K probably null Het
Dnah12 A T 14: 26,766,115 Q992L probably benign Het
Dnajc7 T C 11: 100,596,212 Y145C probably damaging Het
Eml5 A T 12: 98,844,020 D892E possibly damaging Het
Fam193a A G 5: 34,466,195 K23E possibly damaging Het
Fam214b A T 4: 43,035,919 C271S probably benign Het
Filip1 T G 9: 79,820,047 K430T possibly damaging Het
Hip1 A T 5: 135,460,456 N45K probably damaging Het
Hivep2 T C 10: 14,127,837 S60P probably damaging Het
Ighv1-53 A T 12: 115,158,409 C115* probably null Het
Macf1 T C 4: 123,409,651 T353A probably benign Het
Mast3 A T 8: 70,786,635 V433E probably damaging Het
Mast4 A T 13: 102,772,563 M660K probably damaging Het
Nr2e1 T C 10: 42,563,383 Y380C probably damaging Het
Olfr1465 T A 19: 13,314,205 M27L probably benign Het
Otog A G 7: 46,310,147 D720G probably damaging Het
Slc6a1 T A 6: 114,311,898 W473R probably damaging Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Sprr3 T C 3: 92,457,208 I110V possibly damaging Het
Ston1 A G 17: 88,636,144 E326G probably benign Het
Tapbpl T G 6: 125,230,270 Q152P probably damaging Het
Tectb C T 19: 55,194,673 L319F possibly damaging Het
Tpp2 G A 1: 43,960,961 G413D probably damaging Het
Tpsg1 A G 17: 25,373,204 H84R probably damaging Het
Usp24 A G 4: 106,428,489 N2437S probably benign Het
Usp32 T C 11: 85,007,059 Q1152R probably damaging Het
Vmn2r6 T C 3: 64,559,803 T92A probably benign Het
Xpo7 A G 14: 70,707,348 V35A probably benign Het
Zan T A 5: 137,463,579 T1113S unknown Het
Zfp169 A G 13: 48,490,481 V390A unknown Het
Other mutations in Gm5089
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Gm5089 APN 14 122436163 missense unknown
BB010:Gm5089 UTSW 14 122435991 missense unknown
R1710:Gm5089 UTSW 14 122436154 nonsense probably null
R2002:Gm5089 UTSW 14 122436274 missense unknown
R2264:Gm5089 UTSW 14 122436102 missense unknown
R7139:Gm5089 UTSW 14 122435991 missense unknown
R7933:Gm5089 UTSW 14 122435991 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCACTTCATATGCAGTCAGG -3'
(R):5'- CTTGATGAGAAGACAGACTCCG -3'

Sequencing Primer
(F):5'- TATGCAGTCAGGATACACTCAG -3'
(R):5'- TTGGTAGGTAAGCCCAAG -3'
Posted On2020-08-01