Incidental Mutation 'BB020:Olfr1465'
ID643143
Institutional Source Beutler Lab
Gene Symbol Olfr1465
Ensembl Gene ENSMUSG00000062199
Gene Nameolfactory receptor 1465
SynonymsMOR202-28, GA_x6K02T2RE5P-3645346-3644423
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #BB020
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location13312768-13315541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13314205 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 27 (M27L)
Ref Sequence ENSEMBL: ENSMUSP00000146645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080142] [ENSMUST00000207340]
Predicted Effect probably benign
Transcript: ENSMUST00000080142
AA Change: M27L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079039
Gene: ENSMUSG00000062199
AA Change: M27L

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 7.4e-47 PFAM
Pfam:7tm_1 39 288 3.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207340
AA Change: M27L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,751 L85P probably damaging Het
4933414I15Rik A G 11: 50,942,400 V125A unknown Het
Adam34 T A 8: 43,650,874 H578L probably damaging Het
Ago4 A T 4: 126,507,018 M678K probably benign Het
Atrn T C 2: 130,995,066 L1150P probably damaging Het
Camta1 C T 4: 151,083,757 E279K probably damaging Het
Ccdc88c T C 12: 100,945,490 D695G possibly damaging Het
Col11a2 A T 17: 34,056,055 K400* probably null Het
Cpsf4 T A 5: 145,167,358 M1K probably null Het
Dnah12 A T 14: 26,766,115 Q992L probably benign Het
Dnajc7 T C 11: 100,596,212 Y145C probably damaging Het
Eml5 A T 12: 98,844,020 D892E possibly damaging Het
Fam193a A G 5: 34,466,195 K23E possibly damaging Het
Fam214b A T 4: 43,035,919 C271S probably benign Het
Filip1 T G 9: 79,820,047 K430T possibly damaging Het
Gm5089 T C 14: 122,435,991 D106G unknown Het
Hip1 A T 5: 135,460,456 N45K probably damaging Het
Hivep2 T C 10: 14,127,837 S60P probably damaging Het
Ighv1-53 A T 12: 115,158,409 C115* probably null Het
Macf1 T C 4: 123,409,651 T353A probably benign Het
Mast3 A T 8: 70,786,635 V433E probably damaging Het
Mast4 A T 13: 102,772,563 M660K probably damaging Het
Nr2e1 T C 10: 42,563,383 Y380C probably damaging Het
Otog A G 7: 46,310,147 D720G probably damaging Het
Slc6a1 T A 6: 114,311,898 W473R probably damaging Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Sprr3 T C 3: 92,457,208 I110V possibly damaging Het
Ston1 A G 17: 88,636,144 E326G probably benign Het
Tapbpl T G 6: 125,230,270 Q152P probably damaging Het
Tectb C T 19: 55,194,673 L319F possibly damaging Het
Tpp2 G A 1: 43,960,961 G413D probably damaging Het
Tpsg1 A G 17: 25,373,204 H84R probably damaging Het
Usp24 A G 4: 106,428,489 N2437S probably benign Het
Usp32 T C 11: 85,007,059 Q1152R probably damaging Het
Vmn2r6 T C 3: 64,559,803 T92A probably benign Het
Xpo7 A G 14: 70,707,348 V35A probably benign Het
Zan T A 5: 137,463,579 T1113S unknown Het
Zfp169 A G 13: 48,490,481 V390A unknown Het
Other mutations in Olfr1465
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Olfr1465 APN 19 13314126 missense probably damaging 1.00
IGL01548:Olfr1465 APN 19 13313986 missense possibly damaging 0.95
IGL02548:Olfr1465 APN 19 13313938 missense probably damaging 0.98
IGL02663:Olfr1465 APN 19 13313379 missense probably benign 0.01
BB010:Olfr1465 UTSW 19 13314205 missense probably benign
PIT4651001:Olfr1465 UTSW 19 13314192 missense probably benign 0.12
R0563:Olfr1465 UTSW 19 13313748 missense probably benign 0.28
R1803:Olfr1465 UTSW 19 13314171 missense possibly damaging 0.90
R2146:Olfr1465 UTSW 19 13314121 missense probably benign 0.23
R4674:Olfr1465 UTSW 19 13313814 missense probably benign 0.17
R4697:Olfr1465 UTSW 19 13313717 missense probably benign 0.39
R4825:Olfr1465 UTSW 19 13314320 splice site probably null
R4884:Olfr1465 UTSW 19 13313670 missense probably benign 0.28
R5647:Olfr1465 UTSW 19 13314189 missense probably damaging 1.00
R6401:Olfr1465 UTSW 19 13313514 missense probably damaging 1.00
R6913:Olfr1465 UTSW 19 13313634 missense probably benign 0.01
R6996:Olfr1465 UTSW 19 13313672 missense probably benign 0.15
R7933:Olfr1465 UTSW 19 13314205 missense probably benign
R8946:Olfr1465 UTSW 19 13314138 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACACCCATTATAGGATATGACCTTG -3'
(R):5'- GCTCAACCAAGTCATATGTTTGCAC -3'

Sequencing Primer
(F):5'- AGGATATGACCTTGTCTCCTTTTAG -3'
(R):5'- ATGTAACAGTGATGGAGAAC -3'
Posted On2020-08-01