Incidental Mutation 'R8078:Rell1'
ID 643149
Institutional Source Beutler Lab
Gene Symbol Rell1
Ensembl Gene ENSMUSG00000047881
Gene Name RELT-like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock # R8078 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 63908897-63968897 bp(-) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) T to A at 63939721 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087327] [ENSMUST00000154169]
AlphaFold Q8K2J7
Predicted Effect unknown
Transcript: ENSMUST00000087327
AA Change: T44S
SMART Domains Protein: ENSMUSP00000084585
Gene: ENSMUSG00000047881
AA Change: T44S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154169
SMART Domains Protein: ENSMUSP00000118125
Gene: ENSMUSG00000047881

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:RELT 59 103 1.2e-26 PFAM
low complexity region 149 168 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.9%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,301,279 V2884I probably benign Het
Actl10 T A 2: 154,552,570 N147K probably benign Het
Agpat2 C A 2: 26,604,101 C37F possibly damaging Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Ankrd26 T A 6: 118,517,893 probably null Het
Bcas1 T C 2: 170,418,612 E49G possibly damaging Het
Birc3 A G 9: 7,858,741 V331A probably damaging Het
Cadm3 A G 1: 173,341,059 V314A probably damaging Het
Cep290 T C 10: 100,572,887 V2407A probably benign Het
Chd5 C A 4: 152,360,991 N446K possibly damaging Het
Clec9a A G 6: 129,409,033 S27G probably benign Het
Coro1c G T 5: 113,882,103 A17E probably damaging Het
Cspg4 T C 9: 56,890,259 S1336P possibly damaging Het
Ddx55 G A 5: 124,566,388 V353M probably damaging Het
Farp1 T A 14: 121,276,300 S836T probably benign Het
Fbll1 G T 11: 35,797,901 D178E probably benign Het
Flg2 T G 3: 93,200,275 D22E probably damaging Het
Glis1 T A 4: 107,567,902 C237S probably damaging Het
Gm5519 T C 19: 33,822,957 V17A possibly damaging Het
Gucy2c C A 6: 136,697,921 G1055C probably damaging Het
Hspg2 T C 4: 137,508,022 Y123H probably damaging Het
Idh1 T A 1: 65,161,066 I380F probably damaging Het
Il23r A T 6: 67,423,593 N584K probably damaging Het
Lama1 A T 17: 67,791,294 T1829S Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Luzp2 T A 7: 55,052,762 Y24* probably null Het
Masp2 A T 4: 148,613,778 T439S probably benign Het
Meioc G A 11: 102,668,400 W49* probably null Het
Mrvi1 T C 7: 110,899,735 E363G probably damaging Het
Mtor T G 4: 148,468,287 I749S probably benign Het
Myo16 T A 8: 10,562,078 V1241D unknown Het
Ncam2 G T 16: 81,443,248 R199L possibly damaging Het
Nyap2 A G 1: 81,241,057 S265G possibly damaging Het
Olfr1309 T A 2: 111,983,270 D268V probably damaging Het
Parp8 A T 13: 116,924,983 F175I probably damaging Het
Pcnx A G 12: 81,975,280 T823A Het
Phc2 T A 4: 128,711,062 I197N probably damaging Het
Pla2g16 C T 19: 7,579,161 T109I probably benign Het
Pot1a T C 6: 25,750,108 I518M probably benign Het
Prg2 T A 2: 84,982,260 C105S probably benign Het
Rab39 A G 9: 53,705,955 L54P possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Slc4a4 T C 5: 89,179,707 Y668H probably benign Het
Sncg C A 14: 34,374,770 probably benign Het
Spata31d1b A G 13: 59,715,449 D137G probably damaging Het
Tas1r1 C T 4: 152,028,346 G750D probably damaging Het
Tcea3 A T 4: 136,254,514 D61V probably damaging Het
Tfap2c T A 2: 172,551,472 H102Q probably damaging Het
Tmem150a T A 6: 72,358,323 L95H probably damaging Het
Tnfrsf11a A T 1: 105,817,684 D149V probably damaging Het
Tsc22d2 C A 3: 58,416,032 A115E probably benign Het
Vmn2r101 T A 17: 19,590,245 F431Y probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r85 C A 10: 130,429,495 E40* probably null Het
Zfp606 G A 7: 12,481,015 A57T possibly damaging Het
Zfp760 T C 17: 21,723,455 V537A probably benign Het
Other mutations in Rell1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Rell1 APN 5 63937814 missense probably damaging 1.00
IGL02374:Rell1 APN 5 63937808 missense possibly damaging 0.94
IGL02697:Rell1 APN 5 63927011 missense probably damaging 0.96
R0648:Rell1 UTSW 5 63924745 missense probably benign 0.05
R1471:Rell1 UTSW 5 63936085 missense probably damaging 1.00
R3177:Rell1 UTSW 5 63926987 critical splice donor site probably null
R3277:Rell1 UTSW 5 63926987 critical splice donor site probably null
R4095:Rell1 UTSW 5 63968670 missense probably benign
R4921:Rell1 UTSW 5 63936033 missense probably damaging 1.00
R4952:Rell1 UTSW 5 63939667 intron probably benign
R6294:Rell1 UTSW 5 63939705 intron probably benign
R6692:Rell1 UTSW 5 63937867 missense probably damaging 1.00
R7297:Rell1 UTSW 5 63936075 missense possibly damaging 0.86
R8385:Rell1 UTSW 5 63930518 nonsense probably null
X0028:Rell1 UTSW 5 63936095 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGAGGCCTAAAGGTATATGAGC -3'
(R):5'- TTTTAGGCACCCCAACTCAGG -3'

Sequencing Primer
(F):5'- GCCTAAAGGTATATGAGCCTAGTTCC -3'
(R):5'- CTCAGGTAAAAATCGATCTTGGC -3'
Posted On 2020-08-05