Mutagenetix > Incidental Mutation

Incidental Mutation 'R8118:Klhl20'

643159

Institutional Source

Beutler Lab

Gene Symbol

Klhl20

Ensembl Gene

ENSMUSG00000026705

Gene Name

kelch-like 20

Synonyms

D930050H05Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.508) question?

Stock #

R8118 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

161088375-161131511 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 161098401 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000107238 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111611] [ENSMUST00000117467] [ENSMUST00000195584]

AlphaFold

Q8VCK5

Predicted Effect

probably null
Transcript: ENSMUST00000111611

SMART Domains

Protein: ENSMUSP00000107238
Gene: ENSMUSG00000026705

Domain	Start	End	E-Value	Type
BTB	63	160	2.73e-31	SMART
BACK	165	267	1.98e-41	SMART
Kelch	314	360	8.45e-16	SMART
Kelch	361	408	1.35e-14	SMART
Kelch	409	455	5.12e-15	SMART
Kelch	456	502	1.22e-12	SMART
Kelch	503	549	1.35e-14	SMART
Kelch	550	596	1.59e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000117467

SMART Domains

Protein: ENSMUSP00000114044
Gene: ENSMUSG00000026705

Domain	Start	End	E-Value	Type
BTB	63	160	2.73e-31	SMART
BACK	165	267	1.98e-41	SMART
Kelch	314	360	8.45e-16	SMART
Kelch	361	408	1.35e-14	SMART
Kelch	409	455	5.12e-15	SMART
Kelch	456	502	1.22e-12	SMART
Kelch	503	549	1.35e-14	SMART
Kelch	550	596	1.59e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000195584

SMART Domains

Protein: ENSMUSP00000141213
Gene: ENSMUSG00000026705

Domain	Start	End	E-Value	Type
Kelch	1	40	1.43e-4	SMART
Kelch	41	87	1.59e-11	SMART

Coding Region Coverage

1x: 99.8%
3x: 99.5%
10x: 98.2%
20x: 91.1%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kelch family of proteins, which is characterized by a 44-56 amino acid repeat motif. The kelch motif appears in many different polypeptide contexts and contains multiple potential protein-protein contact sites. Members of this family are present both throughout the cell and extracellularly, with diverse activities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit male sterility. Mice homozygous for a gene trap allele exhibit corneal vascularization and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts1	T	C	16: 85,795,933	D792G	probably damaging	Het
Adcy7	A	G	8: 88,315,756	H417R	probably damaging	Het
Agr2	A	G	12: 35,996,107	D79G	probably benign	Het
Ankle1	T	C	8: 71,407,635	S286P	probably benign	Het
Arhgef11	T	C	3: 87,735,857	S1488P	probably damaging	Het
Atp6v0a2	T	C	5: 124,712,773	M421T	probably damaging	Het
Cdk17	C	A	10: 93,216,390	Q111K	possibly damaging	Het
Cobl	A	G	11: 12,254,834	S623P	probably benign	Het
Dgka	C	T	10: 128,722,449		probably null	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Dsg2	A	G	18: 20,582,801	I267V	probably benign	Het
Exoc4	T	C	6: 33,971,918	Y899H	probably damaging	Het
Fat3	A	G	9: 15,960,104	F3664L	probably benign	Het
Fbxo47	C	T	11: 97,879,515	C17Y	probably benign	Het
Gm2888	G	T	14: 3,037,628	V207F	probably benign	Het
Gm7030	C	T	17: 36,127,690	V270M	probably damaging	Het
Gpr61	A	G	3: 108,150,572	S258P	probably damaging	Het
Hectd4	C	T	5: 121,286,376	H700Y	probably benign	Het
Hs3st2	C	T	7: 121,397,428	T154I	probably benign	Het
Inf2	A	T	12: 112,601,437	H167L	probably damaging	Het
Ints3	C	T	3: 90,400,299		probably null	Het
Ippk	C	T	13: 49,446,342	P226S		Het
Itgal	C	A	7: 127,311,245	Q509K	probably benign	Het
Krtap4-13	C	T	11: 99,809,398	C145Y	unknown	Het
Large1	A	G	8: 73,131,944	S99P	probably benign	Het
Lexm	T	A	4: 106,613,398	R192S	possibly damaging	Het
Lrba	A	T	3: 86,354,226	I1496L	probably benign	Het
Map2	A	T	1: 66,425,391	I1647F	probably damaging	Het
Map3k10	A	G	7: 27,673,417	V203A	possibly damaging	Het
Mcmdc2	T	A	1: 9,916,374	N166K	possibly damaging	Het
Mlxipl	T	G	5: 135,137,248	L828R	possibly damaging	Het
Mnat1	A	G	12: 73,219,090	I253V	probably benign	Het
Mtfp1	A	G	11: 4,093,910	S107P	probably damaging	Het
Nebl	T	A	2: 17,379,820	Y65F	possibly damaging	Het
Nelfb	A	T	2: 25,205,159	D339E	possibly damaging	Het
Nlrc3	T	A	16: 3,965,631	I20L	probably benign	Het
Nup205	T	A	6: 35,230,516	M1501K	probably benign	Het
Olfr1487	T	A	19: 13,619,745	N151K	probably damaging	Het
Olfr304	A	T	7: 86,385,768	C297*	probably null	Het
Olfr51	A	G	11: 51,007,500	H176R	probably damaging	Het
Olfr720	A	G	14: 14,175,863	I73T	probably damaging	Het
Olfr725	T	C	14: 50,035,151	D84G	probably benign	Het
Olfr998	T	A	2: 85,590,988	Y149*	probably null	Het
Palm3	A	G	8: 84,029,809	E650G	probably damaging	Het
Prps1l1	C	A	12: 34,985,341	L152M	probably damaging	Het
Rgs7bp	C	A	13: 105,053,121	V57F	probably damaging	Het
Scaf8	T	A	17: 3,164,183	V171D	unknown	Het
Sf3a2	T	C	10: 80,803,640	Y155H	probably damaging	Het
Sfrp1	T	G	8: 23,411,984	L67R	probably damaging	Het
Shank2	A	T	7: 144,409,875	I407L	probably benign	Het
Skint6	T	C	4: 112,865,675	T902A	possibly damaging	Het
Skint6	A	C	4: 113,156,494	S353R	possibly damaging	Het
Srrm2	T	A	17: 23,808,083	I87N	unknown	Het
Stard9	G	A	2: 120,704,430	G3723S	probably benign	Het
Svs3b	A	G	2: 164,256,006	S132P	probably damaging	Het
Tbc1d17	G	T	7: 44,843,002	F412L	probably benign	Het
Tex29	A	T	8: 11,854,263	E116D	unknown	Het
Tmem204	T	C	17: 25,080,338	D69G	possibly damaging	Het
Ttll10	G	A	4: 156,044,762	R308C	probably benign	Het
Ttn	T	A	2: 76,747,164	I24462F	probably damaging	Het
Tubg2	A	G	11: 101,161,478	E411G	probably damaging	Het
Ugt2b38	T	C	5: 87,423,771	N134S	probably damaging	Het
Usp31	T	C	7: 121,677,262	T351A	probably damaging	Het
Usp33	T	C	3: 152,360,359	L92S	probably damaging	Het
Vmn2r20	A	T	6: 123,396,470	I471N	probably damaging	Het
Wdfy4	G	A	14: 33,104,115	P1193L		Het
Wnk2	A	G	13: 49,090,983	V459A	probably damaging	Het

Other mutations in Klhl20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00777:Klhl20	APN	1	161109755	missense	probably benign	0.00
IGL00903:Klhl20	APN	1	161090506	missense	probably benign	0.00
IGL01574:Klhl20	APN	1	161093726	missense	probably damaging	1.00
IGL01721:Klhl20	APN	1	161095587	missense	probably damaging	1.00
IGL01933:Klhl20	APN	1	161106787	missense	probably damaging	1.00
IGL02187:Klhl20	APN	1	161109710	missense	probably benign	0.05
IGL02634:Klhl20	APN	1	161098365	missense	probably damaging	0.98
IGL02691:Klhl20	APN	1	161106874	splice site	probably benign
R0102:Klhl20	UTSW	1	161090445	nonsense	probably null
R0102:Klhl20	UTSW	1	161090445	nonsense	probably null
R0639:Klhl20	UTSW	1	161093711	missense	probably damaging	1.00
R1730:Klhl20	UTSW	1	161102990	missense	possibly damaging	0.82
R1856:Klhl20	UTSW	1	161106742	missense	probably benign	0.00
R2016:Klhl20	UTSW	1	161103038	missense	probably damaging	0.98
R2901:Klhl20	UTSW	1	161109552	nonsense	probably null
R4822:Klhl20	UTSW	1	161093763	nonsense	probably null
R4830:Klhl20	UTSW	1	161098376	missense	probably benign	0.00
R4894:Klhl20	UTSW	1	161109532	missense	possibly damaging	0.76
R4981:Klhl20	UTSW	1	161103005	missense	possibly damaging	0.48
R5018:Klhl20	UTSW	1	161101586	missense	probably damaging	0.98
R5023:Klhl20	UTSW	1	161109220	critical splice donor site	probably null
R5108:Klhl20	UTSW	1	161099250	missense	probably damaging	0.99
R5216:Klhl20	UTSW	1	161093679	critical splice donor site	probably null
R5659:Klhl20	UTSW	1	161090470	missense	probably damaging	1.00
R6159:Klhl20	UTSW	1	161105467	missense	probably damaging	1.00
R6836:Klhl20	UTSW	1	161105406	missense	probably benign	0.18
R6914:Klhl20	UTSW	1	161093696	missense	possibly damaging	0.50
R6915:Klhl20	UTSW	1	161093696	missense	possibly damaging	0.50
R6920:Klhl20	UTSW	1	161093696	missense	possibly damaging	0.50
R7706:Klhl20	UTSW	1	161109257	missense	probably benign	0.01
R7976:Klhl20	UTSW	1	161106737	missense	probably benign	0.02
R7991:Klhl20	UTSW	1	161106864	missense	possibly damaging	0.89
R8085:Klhl20	UTSW	1	161093784	missense	probably damaging	1.00
R8204:Klhl20	UTSW	1	161106844	missense	probably benign	0.04
R8678:Klhl20	UTSW	1	161109427	missense	probably damaging	1.00
R9093:Klhl20	UTSW	1	161095661	nonsense	probably null
R9094:Klhl20	UTSW	1	161105485	missense	probably damaging	1.00
R9360:Klhl20	UTSW	1	161093699	missense	probably benign	0.06
R9532:Klhl20	UTSW	1	161109759	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGGAACTCATACTGCTGTTGAG -3'
(R):5'- CCGTCTACTAGTCTATAGCACAC -3'

Sequencing Primer
(F):5'- CATACTGCTGTTGAGAGACTGACC -3'
(R):5'- CACTGAGAGTGGAATCCTCTACTG -3'

Posted On

2020-08-06