Incidental Mutation 'R8118:Ints3'
ID 643160
Institutional Source Beutler Lab
Gene Symbol Ints3
Ensembl Gene ENSMUSG00000027933
Gene Name integrator complex subunit 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock # R8118 (G1)
Quality Score 187.009
Status Validated
Chromosome 3
Chromosomal Location 90391388-90433622 bp(-) (GRCm38)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) C to T at 90400299 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029542] [ENSMUST00000071488] [ENSMUST00000196530]
AlphaFold Q7TPD0
Predicted Effect probably null
Transcript: ENSMUST00000029542
SMART Domains Protein: ENSMUSP00000029542
Gene: ENSMUSG00000027933

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
Pfam:DUF2356 269 493 6e-110 PFAM
low complexity region 557 568 N/A INTRINSIC
low complexity region 632 647 N/A INTRINSIC
low complexity region 666 678 N/A INTRINSIC
coiled coil region 913 940 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
low complexity region 1021 1031 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000071488
SMART Domains Protein: ENSMUSP00000071422
Gene: ENSMUSG00000027933

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
Pfam:DUF2356 269 493 6e-110 PFAM
low complexity region 557 568 N/A INTRINSIC
low complexity region 632 647 N/A INTRINSIC
low complexity region 666 678 N/A INTRINSIC
coiled coil region 913 940 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
low complexity region 1021 1031 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000196530
SMART Domains Protein: ENSMUSP00000143196
Gene: ENSMUSG00000027933

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
Pfam:DUF2356 268 497 5.7e-114 PFAM
low complexity region 557 568 N/A INTRINSIC
low complexity region 632 647 N/A INTRINSIC
low complexity region 666 678 N/A INTRINSIC
coiled coil region 913 940 N/A INTRINSIC
low complexity region 1006 1018 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.2%
  • 20x: 91.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can form a complex with human single-strand DNA binding proteins 1 or 2 (hSSB1 and hSSB2) and other proteins to mediate genome stability and the DNA damage response. The encoded protein is also part of a multiprotein complex that interacts with the C-terminal domain of RNA polymerase II large subunit to help regulate processing of U1 and U2 small nuclear RNAs. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,795,933 D792G probably damaging Het
Adcy7 A G 8: 88,315,756 H417R probably damaging Het
Agr2 A G 12: 35,996,107 D79G probably benign Het
Ankle1 T C 8: 71,407,635 S286P probably benign Het
Arhgef11 T C 3: 87,735,857 S1488P probably damaging Het
Atp6v0a2 T C 5: 124,712,773 M421T probably damaging Het
Cdk17 C A 10: 93,216,390 Q111K possibly damaging Het
Cobl A G 11: 12,254,834 S623P probably benign Het
Dgka C T 10: 128,722,449 probably null Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Dsg2 A G 18: 20,582,801 I267V probably benign Het
Exoc4 T C 6: 33,971,918 Y899H probably damaging Het
Fat3 A G 9: 15,960,104 F3664L probably benign Het
Fbxo47 C T 11: 97,879,515 C17Y probably benign Het
Gm2888 G T 14: 3,037,628 V207F probably benign Het
Gm7030 C T 17: 36,127,690 V270M probably damaging Het
Gpr61 A G 3: 108,150,572 S258P probably damaging Het
Hectd4 C T 5: 121,286,376 H700Y probably benign Het
Hs3st2 C T 7: 121,397,428 T154I probably benign Het
Inf2 A T 12: 112,601,437 H167L probably damaging Het
Ippk C T 13: 49,446,342 P226S Het
Itgal C A 7: 127,311,245 Q509K probably benign Het
Klhl20 A T 1: 161,098,401 probably null Het
Krtap4-13 C T 11: 99,809,398 C145Y unknown Het
Large1 A G 8: 73,131,944 S99P probably benign Het
Lexm T A 4: 106,613,398 R192S possibly damaging Het
Lrba A T 3: 86,354,226 I1496L probably benign Het
Map2 A T 1: 66,425,391 I1647F probably damaging Het
Map3k10 A G 7: 27,673,417 V203A possibly damaging Het
Mcmdc2 T A 1: 9,916,374 N166K possibly damaging Het
Mlxipl T G 5: 135,137,248 L828R possibly damaging Het
Mnat1 A G 12: 73,219,090 I253V probably benign Het
Mtfp1 A G 11: 4,093,910 S107P probably damaging Het
Nebl T A 2: 17,379,820 Y65F possibly damaging Het
Nelfb A T 2: 25,205,159 D339E possibly damaging Het
Nlrc3 T A 16: 3,965,631 I20L probably benign Het
Nup205 T A 6: 35,230,516 M1501K probably benign Het
Olfr1487 T A 19: 13,619,745 N151K probably damaging Het
Olfr304 A T 7: 86,385,768 C297* probably null Het
Olfr51 A G 11: 51,007,500 H176R probably damaging Het
Olfr720 A G 14: 14,175,863 I73T probably damaging Het
Olfr725 T C 14: 50,035,151 D84G probably benign Het
Olfr998 T A 2: 85,590,988 Y149* probably null Het
Palm3 A G 8: 84,029,809 E650G probably damaging Het
Prps1l1 C A 12: 34,985,341 L152M probably damaging Het
Rgs7bp C A 13: 105,053,121 V57F probably damaging Het
Scaf8 T A 17: 3,164,183 V171D unknown Het
Sf3a2 T C 10: 80,803,640 Y155H probably damaging Het
Sfrp1 T G 8: 23,411,984 L67R probably damaging Het
Shank2 A T 7: 144,409,875 I407L probably benign Het
Skint6 T C 4: 112,865,675 T902A possibly damaging Het
Skint6 A C 4: 113,156,494 S353R possibly damaging Het
Srrm2 T A 17: 23,808,083 I87N unknown Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Svs3b A G 2: 164,256,006 S132P probably damaging Het
Tbc1d17 G T 7: 44,843,002 F412L probably benign Het
Tex29 A T 8: 11,854,263 E116D unknown Het
Tmem204 T C 17: 25,080,338 D69G possibly damaging Het
Ttll10 G A 4: 156,044,762 R308C probably benign Het
Ttn T A 2: 76,747,164 I24462F probably damaging Het
Tubg2 A G 11: 101,161,478 E411G probably damaging Het
Ugt2b38 T C 5: 87,423,771 N134S probably damaging Het
Usp31 T C 7: 121,677,262 T351A probably damaging Het
Usp33 T C 3: 152,360,359 L92S probably damaging Het
Vmn2r20 A T 6: 123,396,470 I471N probably damaging Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Wnk2 A G 13: 49,090,983 V459A probably damaging Het
Other mutations in Ints3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ints3 APN 3 90406329 missense probably damaging 1.00
IGL01339:Ints3 APN 3 90415156 critical splice donor site probably null
IGL01398:Ints3 APN 3 90392823 missense probably damaging 1.00
IGL01599:Ints3 APN 3 90394322 critical splice donor site probably null
IGL01864:Ints3 APN 3 90415179 missense probably benign 0.33
IGL01984:Ints3 APN 3 90392226 missense possibly damaging 0.79
IGL02325:Ints3 APN 3 90404042 missense probably damaging 1.00
IGL02516:Ints3 APN 3 90403108 missense probably damaging 1.00
IGL02867:Ints3 APN 3 90392836 missense probably damaging 1.00
IGL02889:Ints3 APN 3 90392836 missense probably damaging 1.00
IGL02975:Ints3 APN 3 90401837 splice site probably benign
PIT4431001:Ints3 UTSW 3 90396460 missense probably damaging 0.99
R0003:Ints3 UTSW 3 90408511 missense probably benign 0.00
R0003:Ints3 UTSW 3 90408511 missense probably benign 0.00
R0069:Ints3 UTSW 3 90400647 splice site probably benign
R0069:Ints3 UTSW 3 90400647 splice site probably benign
R1450:Ints3 UTSW 3 90432828 missense probably damaging 1.00
R1985:Ints3 UTSW 3 90400303 critical splice donor site probably null
R2324:Ints3 UTSW 3 90394094 missense probably damaging 1.00
R2425:Ints3 UTSW 3 90394110 missense possibly damaging 0.91
R2920:Ints3 UTSW 3 90393162 missense probably benign 0.22
R3937:Ints3 UTSW 3 90403987 nonsense probably null
R4678:Ints3 UTSW 3 90408510 missense possibly damaging 0.47
R4679:Ints3 UTSW 3 90408510 missense possibly damaging 0.47
R4719:Ints3 UTSW 3 90415521 missense probably benign 0.20
R4726:Ints3 UTSW 3 90393777 missense probably damaging 1.00
R4993:Ints3 UTSW 3 90415507 missense probably benign 0.05
R5154:Ints3 UTSW 3 90415561 missense probably benign 0.01
R5243:Ints3 UTSW 3 90401144 frame shift probably null
R5454:Ints3 UTSW 3 90408527 missense possibly damaging 0.72
R5678:Ints3 UTSW 3 90403548 missense probably damaging 0.99
R6123:Ints3 UTSW 3 90413554 missense probably benign 0.01
R6548:Ints3 UTSW 3 90392124 unclassified probably benign
R6916:Ints3 UTSW 3 90406334 missense probably damaging 1.00
R7265:Ints3 UTSW 3 90403983 critical splice donor site probably null
R7332:Ints3 UTSW 3 90415512 missense probably damaging 0.98
R7699:Ints3 UTSW 3 90421804 missense probably benign 0.00
R7700:Ints3 UTSW 3 90421804 missense probably benign 0.00
R7790:Ints3 UTSW 3 90400413 missense probably benign 0.09
R7827:Ints3 UTSW 3 90424012 missense probably benign 0.11
R7915:Ints3 UTSW 3 90432825 missense probably benign 0.06
R8119:Ints3 UTSW 3 90392300 missense probably damaging 0.97
R8193:Ints3 UTSW 3 90400622 missense possibly damaging 0.82
R8468:Ints3 UTSW 3 90406253 missense probably damaging 0.96
R9240:Ints3 UTSW 3 90403103 missense possibly damaging 0.82
R9260:Ints3 UTSW 3 90401161 missense probably damaging 0.99
R9486:Ints3 UTSW 3 90406272 nonsense probably null
R9634:Ints3 UTSW 3 90411299 missense
R9656:Ints3 UTSW 3 90392532 missense probably null 0.01
R9744:Ints3 UTSW 3 90411298 missense probably damaging 1.00
Z1177:Ints3 UTSW 3 90406356 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTATATTTCTGGCCCATATCTGTC -3'
(R):5'- GCACCTTAGGAGAGCCTATG -3'

Sequencing Primer
(F):5'- ACATGCCCACTGCTATGGTG -3'
(R):5'- ATGCTAGGTGACACCCTTTTG -3'
Posted On 2020-08-06