Incidental Mutation 'R8118:Ints3'
ID 643160
Institutional Source Beutler Lab
Gene Symbol Ints3
Ensembl Gene ENSMUSG00000027933
Gene Name integrator complex subunit 3
Synonyms
MMRRC Submission 067547-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.968) question?
Stock # R8118 (G1)
Quality Score 187.009
Status Validated
Chromosome 3
Chromosomal Location 90298695-90340929 bp(-) (GRCm39)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) C to T at 90307606 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029542] [ENSMUST00000071488] [ENSMUST00000196530]
AlphaFold Q7TPD0
Predicted Effect probably null
Transcript: ENSMUST00000029542
SMART Domains Protein: ENSMUSP00000029542
Gene: ENSMUSG00000027933

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
Pfam:DUF2356 269 493 6e-110 PFAM
low complexity region 557 568 N/A INTRINSIC
low complexity region 632 647 N/A INTRINSIC
low complexity region 666 678 N/A INTRINSIC
coiled coil region 913 940 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
low complexity region 1021 1031 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000071488
SMART Domains Protein: ENSMUSP00000071422
Gene: ENSMUSG00000027933

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
Pfam:DUF2356 269 493 6e-110 PFAM
low complexity region 557 568 N/A INTRINSIC
low complexity region 632 647 N/A INTRINSIC
low complexity region 666 678 N/A INTRINSIC
coiled coil region 913 940 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
low complexity region 1021 1031 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000196530
SMART Domains Protein: ENSMUSP00000143196
Gene: ENSMUSG00000027933

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
Pfam:DUF2356 268 497 5.7e-114 PFAM
low complexity region 557 568 N/A INTRINSIC
low complexity region 632 647 N/A INTRINSIC
low complexity region 666 678 N/A INTRINSIC
coiled coil region 913 940 N/A INTRINSIC
low complexity region 1006 1018 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.2%
  • 20x: 91.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can form a complex with human single-strand DNA binding proteins 1 or 2 (hSSB1 and hSSB2) and other proteins to mediate genome stability and the DNA damage response. The encoded protein is also part of a multiprotein complex that interacts with the C-terminal domain of RNA polymerase II large subunit to help regulate processing of U1 and U2 small nuclear RNAs. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,592,821 (GRCm39) D792G probably damaging Het
Adcy7 A G 8: 89,042,384 (GRCm39) H417R probably damaging Het
Agr2 A G 12: 36,046,106 (GRCm39) D79G probably benign Het
Ankle1 T C 8: 71,860,279 (GRCm39) S286P probably benign Het
Arhgef11 T C 3: 87,643,164 (GRCm39) S1488P probably damaging Het
Atp6v0a2 T C 5: 124,789,837 (GRCm39) M421T probably damaging Het
Cdk17 C A 10: 93,052,252 (GRCm39) Q111K possibly damaging Het
Cimap2 T A 4: 106,470,595 (GRCm39) R192S possibly damaging Het
Cobl A G 11: 12,204,834 (GRCm39) S623P probably benign Het
Dgka C T 10: 128,558,318 (GRCm39) probably null Het
Dsc2 C T 18: 20,165,331 (GRCm39) G881R possibly damaging Het
Dsg2 A G 18: 20,715,858 (GRCm39) I267V probably benign Het
Exoc4 T C 6: 33,948,853 (GRCm39) Y899H probably damaging Het
Fat3 A G 9: 15,871,400 (GRCm39) F3664L probably benign Het
Fbxo47 C T 11: 97,770,341 (GRCm39) C17Y probably benign Het
Gm2888 G T 14: 3,037,628 (GRCm38) V207F probably benign Het
Gpr61 A G 3: 108,057,888 (GRCm39) S258P probably damaging Het
H2-T9 C T 17: 36,438,582 (GRCm39) V270M probably damaging Het
Hectd4 C T 5: 121,424,439 (GRCm39) H700Y probably benign Het
Hs3st2 C T 7: 120,996,651 (GRCm39) T154I probably benign Het
Inf2 A T 12: 112,567,871 (GRCm39) H167L probably damaging Het
Ippk C T 13: 49,599,818 (GRCm39) P226S Het
Itgal C A 7: 126,910,417 (GRCm39) Q509K probably benign Het
Klhl20 A T 1: 160,925,971 (GRCm39) probably null Het
Krtap4-13 C T 11: 99,700,224 (GRCm39) C145Y unknown Het
Large1 A G 8: 73,858,572 (GRCm39) S99P probably benign Het
Lrba A T 3: 86,261,533 (GRCm39) I1496L probably benign Het
Map2 A T 1: 66,464,550 (GRCm39) I1647F probably damaging Het
Map3k10 A G 7: 27,372,842 (GRCm39) V203A possibly damaging Het
Mcmdc2 T A 1: 9,986,599 (GRCm39) N166K possibly damaging Het
Mlxipl T G 5: 135,166,102 (GRCm39) L828R possibly damaging Het
Mnat1 A G 12: 73,265,864 (GRCm39) I253V probably benign Het
Mtfp1 A G 11: 4,043,910 (GRCm39) S107P probably damaging Het
Nebl T A 2: 17,384,631 (GRCm39) Y65F possibly damaging Het
Nelfb A T 2: 25,095,171 (GRCm39) D339E possibly damaging Het
Nlrc3 T A 16: 3,783,495 (GRCm39) I20L probably benign Het
Nup205 T A 6: 35,207,451 (GRCm39) M1501K probably benign Het
Or14a258 A T 7: 86,034,976 (GRCm39) C297* probably null Het
Or1ad8 A G 11: 50,898,327 (GRCm39) H176R probably damaging Het
Or2t6 A G 14: 14,175,863 (GRCm38) I73T probably damaging Het
Or4k15b T C 14: 50,272,608 (GRCm39) D84G probably benign Het
Or5b123 T A 19: 13,597,109 (GRCm39) N151K probably damaging Het
Or5g29 T A 2: 85,421,332 (GRCm39) Y149* probably null Het
Palm3 A G 8: 84,756,438 (GRCm39) E650G probably damaging Het
Prps1l1 C A 12: 35,035,340 (GRCm39) L152M probably damaging Het
Rgs7bp C A 13: 105,189,629 (GRCm39) V57F probably damaging Het
Scaf8 T A 17: 3,214,458 (GRCm39) V171D unknown Het
Sf3a2 T C 10: 80,639,474 (GRCm39) Y155H probably damaging Het
Sfrp1 T G 8: 23,902,000 (GRCm39) L67R probably damaging Het
Shank2 A T 7: 143,963,612 (GRCm39) I407L probably benign Het
Skint6 T C 4: 112,722,872 (GRCm39) T902A possibly damaging Het
Skint6 A C 4: 113,013,691 (GRCm39) S353R possibly damaging Het
Srrm2 T A 17: 24,027,057 (GRCm39) I87N unknown Het
Stard9 G A 2: 120,534,911 (GRCm39) G3723S probably benign Het
Svs3b A G 2: 164,097,926 (GRCm39) S132P probably damaging Het
Tbc1d17 G T 7: 44,492,426 (GRCm39) F412L probably benign Het
Tex29 A T 8: 11,904,263 (GRCm39) E116D unknown Het
Tmem204 T C 17: 25,299,312 (GRCm39) D69G possibly damaging Het
Ttll10 G A 4: 156,129,219 (GRCm39) R308C probably benign Het
Ttn T A 2: 76,577,508 (GRCm39) I24462F probably damaging Het
Tubg2 A G 11: 101,052,304 (GRCm39) E411G probably damaging Het
Ugt2b38 T C 5: 87,571,630 (GRCm39) N134S probably damaging Het
Usp31 T C 7: 121,276,485 (GRCm39) T351A probably damaging Het
Usp33 T C 3: 152,065,996 (GRCm39) L92S probably damaging Het
Vmn2r20 A T 6: 123,373,429 (GRCm39) I471N probably damaging Het
Wdfy4 G A 14: 32,826,072 (GRCm39) P1193L Het
Wnk2 A G 13: 49,244,459 (GRCm39) V459A probably damaging Het
Other mutations in Ints3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ints3 APN 3 90,313,636 (GRCm39) missense probably damaging 1.00
IGL01339:Ints3 APN 3 90,322,463 (GRCm39) critical splice donor site probably null
IGL01398:Ints3 APN 3 90,300,130 (GRCm39) missense probably damaging 1.00
IGL01599:Ints3 APN 3 90,301,629 (GRCm39) critical splice donor site probably null
IGL01864:Ints3 APN 3 90,322,486 (GRCm39) missense probably benign 0.33
IGL01984:Ints3 APN 3 90,299,533 (GRCm39) missense possibly damaging 0.79
IGL02325:Ints3 APN 3 90,311,349 (GRCm39) missense probably damaging 1.00
IGL02516:Ints3 APN 3 90,310,415 (GRCm39) missense probably damaging 1.00
IGL02867:Ints3 APN 3 90,300,143 (GRCm39) missense probably damaging 1.00
IGL02889:Ints3 APN 3 90,300,143 (GRCm39) missense probably damaging 1.00
IGL02975:Ints3 APN 3 90,309,144 (GRCm39) splice site probably benign
PIT4431001:Ints3 UTSW 3 90,303,767 (GRCm39) missense probably damaging 0.99
R0003:Ints3 UTSW 3 90,315,818 (GRCm39) missense probably benign 0.00
R0003:Ints3 UTSW 3 90,315,818 (GRCm39) missense probably benign 0.00
R0069:Ints3 UTSW 3 90,307,954 (GRCm39) splice site probably benign
R0069:Ints3 UTSW 3 90,307,954 (GRCm39) splice site probably benign
R1450:Ints3 UTSW 3 90,340,135 (GRCm39) missense probably damaging 1.00
R1985:Ints3 UTSW 3 90,307,610 (GRCm39) critical splice donor site probably null
R2324:Ints3 UTSW 3 90,301,401 (GRCm39) missense probably damaging 1.00
R2425:Ints3 UTSW 3 90,301,417 (GRCm39) missense possibly damaging 0.91
R2920:Ints3 UTSW 3 90,300,469 (GRCm39) missense probably benign 0.22
R3937:Ints3 UTSW 3 90,311,294 (GRCm39) nonsense probably null
R4678:Ints3 UTSW 3 90,315,817 (GRCm39) missense possibly damaging 0.47
R4679:Ints3 UTSW 3 90,315,817 (GRCm39) missense possibly damaging 0.47
R4719:Ints3 UTSW 3 90,322,828 (GRCm39) missense probably benign 0.20
R4726:Ints3 UTSW 3 90,301,084 (GRCm39) missense probably damaging 1.00
R4993:Ints3 UTSW 3 90,322,814 (GRCm39) missense probably benign 0.05
R5154:Ints3 UTSW 3 90,322,868 (GRCm39) missense probably benign 0.01
R5243:Ints3 UTSW 3 90,308,451 (GRCm39) frame shift probably null
R5454:Ints3 UTSW 3 90,315,834 (GRCm39) missense possibly damaging 0.72
R5678:Ints3 UTSW 3 90,310,855 (GRCm39) missense probably damaging 0.99
R6123:Ints3 UTSW 3 90,320,861 (GRCm39) missense probably benign 0.01
R6548:Ints3 UTSW 3 90,299,431 (GRCm39) unclassified probably benign
R6916:Ints3 UTSW 3 90,313,641 (GRCm39) missense probably damaging 1.00
R7265:Ints3 UTSW 3 90,311,290 (GRCm39) critical splice donor site probably null
R7332:Ints3 UTSW 3 90,322,819 (GRCm39) missense probably damaging 0.98
R7699:Ints3 UTSW 3 90,329,111 (GRCm39) missense probably benign 0.00
R7700:Ints3 UTSW 3 90,329,111 (GRCm39) missense probably benign 0.00
R7790:Ints3 UTSW 3 90,307,720 (GRCm39) missense probably benign 0.09
R7827:Ints3 UTSW 3 90,331,319 (GRCm39) missense probably benign 0.11
R7915:Ints3 UTSW 3 90,340,132 (GRCm39) missense probably benign 0.06
R8119:Ints3 UTSW 3 90,299,607 (GRCm39) missense probably damaging 0.97
R8193:Ints3 UTSW 3 90,307,929 (GRCm39) missense possibly damaging 0.82
R8468:Ints3 UTSW 3 90,313,560 (GRCm39) missense probably damaging 0.96
R9240:Ints3 UTSW 3 90,310,410 (GRCm39) missense possibly damaging 0.82
R9260:Ints3 UTSW 3 90,308,468 (GRCm39) missense probably damaging 0.99
R9486:Ints3 UTSW 3 90,313,579 (GRCm39) nonsense probably null
R9634:Ints3 UTSW 3 90,318,606 (GRCm39) missense
R9656:Ints3 UTSW 3 90,299,839 (GRCm39) missense probably null 0.01
R9744:Ints3 UTSW 3 90,318,605 (GRCm39) missense probably damaging 1.00
Z1177:Ints3 UTSW 3 90,313,663 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTATATTTCTGGCCCATATCTGTC -3'
(R):5'- GCACCTTAGGAGAGCCTATG -3'

Sequencing Primer
(F):5'- ACATGCCCACTGCTATGGTG -3'
(R):5'- ATGCTAGGTGACACCCTTTTG -3'
Posted On 2020-08-06