Incidental Mutation 'R8077:Olfr420'
ID643162
Institutional Source Beutler Lab
Gene Symbol Olfr420
Ensembl Gene ENSMUSG00000055033
Gene Nameolfactory receptor 420
SynonymsGA_x6K02T2P20D-20995211-20994246, MOR105-10
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R8077 (G1)
Quality Score67.0074
Status Validated
Chromosome1
Chromosomal Location174155633-174162195 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 174151845 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179386] [ENSMUST00000213748]
Predicted Effect
SMART Domains Protein: ENSMUSP00000136689
Gene: ENSMUSG00000091950
AA Change: T110A

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
Pfam:7tm_1 41 288 5.6e-29 PFAM
Pfam:7tm_4 139 285 4.7e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213748
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,237 V132E probably benign Het
4930563M21Rik C T 9: 55,987,966 V315M probably damaging Het
9430007A20Rik T C 4: 144,528,556 I182T probably benign Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Amotl1 A T 9: 14,550,502 V805D probably damaging Het
Arhgef3 T C 14: 27,385,924 L179P probably damaging Het
Atp8b3 G A 10: 80,531,024 L247F possibly damaging Het
Ccdc191 T C 16: 43,915,605 probably null Het
Celsr3 A G 9: 108,828,331 H671R probably benign Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap97 G T 8: 46,170,445 V291F possibly damaging Het
Clca2 A G 3: 145,071,527 V861A possibly damaging Het
Cln8 A T 8: 14,894,950 D88V probably damaging Het
Col18a1 C A 10: 77,080,851 G330V unknown Het
Dis3 C T 14: 99,090,035 R344Q probably benign Het
Esyt2 T A 12: 116,342,228 S359R possibly damaging Het
Fbxo41 A T 6: 85,473,229 L844Q probably damaging Het
Fn1 G A 1: 71,612,602 T1372M probably damaging Het
Gbp5 G A 3: 142,507,739 R472H probably benign Het
Gm156 A G 6: 129,766,695 Y209H probably benign Het
Gm21964 C T 8: 110,110,103 T207M probably damaging Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gm9507 T A 10: 77,811,770 E25V unknown Het
Gm9573 TCAGTGGTGGTCAGGATGGGGGTAGAGCCTGAGCCACTCCTGGATGCAGTGGTGGTCAGG TCAGTGGTGGTCAGG 17: 35,619,736 probably benign Het
Golgb1 A G 16: 36,918,633 I2486V probably damaging Het
Ifitm10 A T 7: 142,370,967 V45D probably damaging Het
Ift80 A G 3: 68,916,145 Y595H probably benign Het
Itga8 C T 2: 12,242,433 V326I probably benign Het
Kif14 A T 1: 136,471,448 H449L possibly damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lrrc8b C A 5: 105,480,017 S76R possibly damaging Het
Lrrn1 T C 6: 107,568,822 L527P probably damaging Het
Luc7l T C 17: 26,255,073 V35A probably damaging Het
Luzp1 T G 4: 136,543,091 V875G probably damaging Het
Mcf2l G T 8: 12,998,494 probably null Het
Mcoln2 T C 3: 146,190,414 M497T probably damaging Het
Mrgprb4 A T 7: 48,198,455 S242T probably benign Het
Nipbl T A 15: 8,311,250 R1995S possibly damaging Het
Nup35 A G 2: 80,638,936 probably null Het
Olfr1394 A G 11: 49,160,485 D157G probably damaging Het
Olfr45 C T 7: 140,691,133 S76F probably benign Het
Prdm12 A G 2: 31,642,304 K109E probably damaging Het
Ptch1 A T 13: 63,540,812 L444Q probably damaging Het
Qtrt1 C T 9: 21,420,096 R374* probably null Het
Rnase11 T C 14: 51,049,941 D52G probably damaging Het
Rps6 A G 4: 86,855,921 S148P probably benign Het
Rrm2b T C 15: 37,946,800 K86E possibly damaging Het
Sh2d1b2 A G 1: 170,248,173 K59E possibly damaging Het
Six6 T A 12: 72,940,326 W91R probably damaging Het
Slc23a2 C A 2: 132,089,172 A136S possibly damaging Het
Slc9a5 G A 8: 105,359,380 R593H probably damaging Het
Smbd1 T C 16: 32,810,434 M1V probably null Het
Ssbp4 T C 8: 70,598,997 Y239C probably damaging Het
Stox1 T C 10: 62,665,566 E405G probably damaging Het
Tmem192 A G 8: 64,965,544 I194V probably benign Het
Tns3 A T 11: 8,445,667 C1246S probably damaging Het
Ugt1a6a A T 1: 88,138,853 Q127L probably benign Het
Ush2a A G 1: 188,542,828 I1833V probably benign Het
Vmn2r66 A T 7: 85,006,885 Y308N probably benign Het
Vti1a T G 19: 55,576,485 L191R probably benign Het
Zbtb38 A T 9: 96,688,100 N310K probably benign Het
Other mutations in Olfr420
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Olfr420 APN 1 174158857 missense probably damaging 1.00
IGL02479:Olfr420 APN 1 174158954 nonsense probably null
IGL03190:Olfr420 APN 1 174159544 missense probably damaging 0.99
IGL03270:Olfr420 APN 1 174159553 missense probably benign 0.04
R0645:Olfr420 UTSW 1 174159354 missense probably benign 0.00
R0834:Olfr420 UTSW 1 174159364 missense possibly damaging 0.55
R1432:Olfr420 UTSW 1 174158917 missense possibly damaging 0.67
R1508:Olfr420 UTSW 1 174159364 missense possibly damaging 0.55
R2351:Olfr420 UTSW 1 174158920 missense probably damaging 0.99
R3440:Olfr420 UTSW 1 174159180 missense probably benign 0.14
R3441:Olfr420 UTSW 1 174159180 missense probably benign 0.14
R4571:Olfr420 UTSW 1 174158928 missense possibly damaging 0.77
R5072:Olfr420 UTSW 1 174158961 missense probably damaging 1.00
R6060:Olfr420 UTSW 1 174159341 nonsense probably null
R6166:Olfr420 UTSW 1 174159093 missense probably benign 0.43
R6228:Olfr420 UTSW 1 174152146 missense probably benign 0.00
R6272:Olfr420 UTSW 1 174159175 missense probably benign 0.02
R6298:Olfr420 UTSW 1 174152182 missense probably benign 0.02
R6400:Olfr420 UTSW 1 174159264 missense probably damaging 0.99
R7581:Olfr420 UTSW 1 174158771 utr 5 prime probably null
R7677:Olfr420 UTSW 1 174159048 missense probably damaging 1.00
R7823:Olfr420 UTSW 1 174159688 missense probably benign 0.12
R7829:Olfr420 UTSW 1 174158859 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGACACTCGTCTTCATAATCCC -3'
(R):5'- CAGGCTAACTTCAACAAAGGGG -3'

Sequencing Primer
(F):5'- ACACTCGTCTTCATAATCCCATGTAC -3'
(R):5'- CTAACTTCAACAAAGGGGTGAAATC -3'
Posted On2020-08-07