Incidental Mutation 'R8077:Nup35'
ID643163
Institutional Source Beutler Lab
Gene Symbol Nup35
Ensembl Gene ENSMUSG00000026999
Gene Namenucleoporin 35
Synonyms2310006I24Rik, 5330402E05Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8077 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location80617236-80658906 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 80638936 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028382] [ENSMUST00000124377]
Predicted Effect probably null
Transcript: ENSMUST00000028382
SMART Domains Protein: ENSMUSP00000028382
Gene: ENSMUSG00000026999

DomainStartEndE-ValueType
Pfam:Nup35_RRM 166 251 8.2e-30 PFAM
Pfam:Nup35_RRM_2 172 224 9.5e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124377
SMART Domains Protein: ENSMUSP00000122132
Gene: ENSMUSG00000026999

DomainStartEndE-ValueType
PDB:4LIR|B 150 179 3e-14 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nucleoporin family. The encoded protein contains two membrane binding regions, is localized to the nuclear rim, and is part of the nuclear pore complex. All molecules entering or leaving the nucleus either diffuse through or are actively transported by the nuclear pore complex. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene have been defined on chromosomes 7 and 10. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous knockout through a point mutation in a critical functional domain leads to early death as a result of megacolon caused by colon myopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,237 V132E probably benign Het
4930563M21Rik C T 9: 55,987,966 V315M probably damaging Het
9430007A20Rik T C 4: 144,528,556 I182T probably benign Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Amotl1 A T 9: 14,550,502 V805D probably damaging Het
Arhgef3 T C 14: 27,385,924 L179P probably damaging Het
Atp8b3 G A 10: 80,531,024 L247F possibly damaging Het
Ccdc191 T C 16: 43,915,605 probably null Het
Celsr3 A G 9: 108,828,331 H671R probably benign Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap97 G T 8: 46,170,445 V291F possibly damaging Het
Clca2 A G 3: 145,071,527 V861A possibly damaging Het
Cln8 A T 8: 14,894,950 D88V probably damaging Het
Col18a1 C A 10: 77,080,851 G330V unknown Het
Dis3 C T 14: 99,090,035 R344Q probably benign Het
Esyt2 T A 12: 116,342,228 S359R possibly damaging Het
Fbxo41 A T 6: 85,473,229 L844Q probably damaging Het
Fn1 G A 1: 71,612,602 T1372M probably damaging Het
Gbp5 G A 3: 142,507,739 R472H probably benign Het
Gm156 A G 6: 129,766,695 Y209H probably benign Het
Gm21964 C T 8: 110,110,103 T207M probably damaging Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gm9507 T A 10: 77,811,770 E25V unknown Het
Gm9573 TCAGTGGTGGTCAGGATGGGGGTAGAGCCTGAGCCACTCCTGGATGCAGTGGTGGTCAGG TCAGTGGTGGTCAGG 17: 35,619,736 probably benign Het
Golgb1 A G 16: 36,918,633 I2486V probably damaging Het
Ifitm10 A T 7: 142,370,967 V45D probably damaging Het
Ift80 A G 3: 68,916,145 Y595H probably benign Het
Itga8 C T 2: 12,242,433 V326I probably benign Het
Kif14 A T 1: 136,471,448 H449L possibly damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lrrc8b C A 5: 105,480,017 S76R possibly damaging Het
Lrrn1 T C 6: 107,568,822 L527P probably damaging Het
Luc7l T C 17: 26,255,073 V35A probably damaging Het
Luzp1 T G 4: 136,543,091 V875G probably damaging Het
Mcf2l G T 8: 12,998,494 probably null Het
Mcoln2 T C 3: 146,190,414 M497T probably damaging Het
Mrgprb4 A T 7: 48,198,455 S242T probably benign Het
Nipbl T A 15: 8,311,250 R1995S possibly damaging Het
Olfr1394 A G 11: 49,160,485 D157G probably damaging Het
Olfr420 A G 1: 174,151,845 probably benign Het
Olfr45 C T 7: 140,691,133 S76F probably benign Het
Prdm12 A G 2: 31,642,304 K109E probably damaging Het
Ptch1 A T 13: 63,540,812 L444Q probably damaging Het
Qtrt1 C T 9: 21,420,096 R374* probably null Het
Rnase11 T C 14: 51,049,941 D52G probably damaging Het
Rps6 A G 4: 86,855,921 S148P probably benign Het
Rrm2b T C 15: 37,946,800 K86E possibly damaging Het
Sh2d1b2 A G 1: 170,248,173 K59E possibly damaging Het
Six6 T A 12: 72,940,326 W91R probably damaging Het
Slc23a2 C A 2: 132,089,172 A136S possibly damaging Het
Slc9a5 G A 8: 105,359,380 R593H probably damaging Het
Smbd1 T C 16: 32,810,434 M1V probably null Het
Ssbp4 T C 8: 70,598,997 Y239C probably damaging Het
Stox1 T C 10: 62,665,566 E405G probably damaging Het
Tmem192 A G 8: 64,965,544 I194V probably benign Het
Tns3 A T 11: 8,445,667 C1246S probably damaging Het
Ugt1a6a A T 1: 88,138,853 Q127L probably benign Het
Ush2a A G 1: 188,542,828 I1833V probably benign Het
Vmn2r66 A T 7: 85,006,885 Y308N probably benign Het
Vti1a T G 19: 55,576,485 L191R probably benign Het
Zbtb38 A T 9: 96,688,100 N310K probably benign Het
Other mutations in Nup35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00645:Nup35 APN 2 80654832 missense probably damaging 1.00
IGL02039:Nup35 APN 2 80642775 missense probably benign 0.04
IGL02538:Nup35 APN 2 80644219 missense possibly damaging 0.83
IGL03167:Nup35 APN 2 80658316 unclassified probably benign
R0540:Nup35 UTSW 2 80642640 missense probably benign 0.11
R0607:Nup35 UTSW 2 80642640 missense probably benign 0.11
R4029:Nup35 UTSW 2 80652974 missense probably benign 0.04
R4050:Nup35 UTSW 2 80655976 missense probably benign 0.30
R4130:Nup35 UTSW 2 80656099 unclassified probably benign
R4131:Nup35 UTSW 2 80656099 unclassified probably benign
R4477:Nup35 UTSW 2 80657143 unclassified probably benign
R6374:Nup35 UTSW 2 80658386 missense probably benign 0.00
R7191:Nup35 UTSW 2 80658379 missense probably damaging 1.00
R7723:Nup35 UTSW 2 80656031 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ACATGGTAAAGAAGGTTGCCC -3'
(R):5'- ATCCTCGTGCATGCTTTCGG -3'

Sequencing Primer
(F):5'- GAAGGTTGCCCTCTTCCAAAATGG -3'
(R):5'- CGTGCATGCTTTCGGGGTAC -3'
Posted On2020-08-07