Incidental Mutation 'R8147:Gen1'
ID643168
Institutional Source Beutler Lab
Gene Symbol Gen1
Ensembl Gene ENSMUSG00000051235
Gene NameGEN1, Holliday junction 5' flap endonuclease
Synonyms5830483C08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R8147 (G1)
Quality Score46.0072
Status Validated
Chromosome12
Chromosomal Location11238920-11265801 bp(-) (GRCm38)
Type of Mutationsplice site (107 bp from exon)
DNA Base Change (assembly) A to T at 11255050 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166117] [ENSMUST00000218259] [ENSMUST00000218487] [ENSMUST00000218547]
Predicted Effect probably null
Transcript: ENSMUST00000166117
SMART Domains Protein: ENSMUSP00000132098
Gene: ENSMUSG00000051235

DomainStartEndE-ValueType
XPGN 1 96 9.13e-22 SMART
XPGI 122 193 5.32e-23 SMART
HhH2 195 229 2.87e-5 SMART
low complexity region 704 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218259
Predicted Effect probably null
Transcript: ENSMUST00000218487
Predicted Effect probably benign
Transcript: ENSMUST00000218547
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.5%
  • 20x: 94.3%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rad2/xeroderma pigmentosum group G nuclease family, whose members are characterized by N-terminal and internal xeroderma pigmentosum group G nuclease domains followed by helix-hairpin-helix domains and disordered C-terminal domains. The protein encoded by this gene is involved in resolution of Holliday junctions, which are intermediate four-way structures that covalently link DNA during homologous recombination and double-strand break repair. The protein resolves Holliday junctions by creating dual incisions across the junction to produce nicked duplex products that can be ligated. In addition, this protein has been found to localize to centrosomes where it has been implicated in regulation of centrosome integrity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 T C 16: 56,742,513 E487G probably damaging Het
Aldh9a1 T A 1: 167,357,380 I287N probably damaging Het
Aox2 T A 1: 58,300,662 N371K probably benign Het
Atr T A 9: 95,899,060 F1392L probably damaging Het
Bicra G A 7: 15,988,470 P374L possibly damaging Het
Cacna1b C T 2: 24,679,176 R912Q probably damaging Het
Cdhr1 T C 14: 37,079,652 N778S probably benign Het
Col4a3bp C T 13: 96,543,228 P22L probably benign Het
Dgat2 C T 7: 99,156,980 V337I possibly damaging Het
Dlg5 T C 14: 24,158,327 D937G probably benign Het
Dqx1 T C 6: 83,060,241 V295A probably benign Het
Dsg3 A G 18: 20,540,073 T934A probably benign Het
Fam81b A C 13: 76,235,021 V243G probably damaging Het
Glrx3 G A 7: 137,463,007 S275N probably benign Het
Igdcc4 A T 9: 65,123,971 Q397L probably benign Het
Ints6 C T 14: 62,713,737 G281D probably damaging Het
Kalrn A T 16: 34,055,044 S1722T probably benign Het
Lrrc4b A G 7: 44,462,405 D567G probably damaging Het
Macf1 A G 4: 123,491,698 L1200S probably damaging Het
Mad1l1 G A 5: 140,143,979 R434C probably damaging Het
Mia3 A T 1: 183,328,207 F358I Het
Ncapd3 C T 9: 27,030,718 probably benign Het
Nfkb2 A G 19: 46,307,434 R156G possibly damaging Het
Nus1 T C 10: 52,429,320 probably null Het
Olfr1107 T A 2: 87,071,673 I154F probably benign Het
Olfr1183 T C 2: 88,462,083 F267L possibly damaging Het
Olfr1252 T A 2: 89,721,842 I90F probably damaging Het
Olfr1384 C T 11: 49,514,223 T195I probably benign Het
Pafah1b2 A G 9: 45,983,849 probably null Het
Pold2 T C 11: 5,876,842 T31A probably benign Het
Ppp1r12b T C 1: 134,873,942 N512S possibly damaging Het
Prl8a8 A T 13: 27,511,581 L23Q probably damaging Het
Ptprb T C 10: 116,317,378 V293A probably damaging Het
Rpl18a G T 8: 70,895,425 T174N probably damaging Het
Senp5 A T 16: 31,989,310 H375Q probably benign Het
Setbp1 A T 18: 78,856,800 F1217L probably damaging Het
Skint4 A G 4: 112,136,021 I314V probably benign Het
Slc28a2 A G 2: 122,458,201 D596G probably benign Het
Stat5b A G 11: 100,797,781 I285T probably benign Het
Sycp3 T C 10: 88,462,605 probably null Het
Sympk T C 7: 19,036,793 F270L probably damaging Het
Taar5 T C 10: 23,970,851 V49A probably damaging Het
Tbx18 C T 9: 87,724,358 V245I probably damaging Het
Tet1 A G 10: 62,878,807 M403T probably benign Het
Tmprss11f A T 5: 86,529,910 F333L probably damaging Het
Tnpo3 T C 6: 29,589,214 I46V probably benign Het
Traf5 G T 1: 192,062,684 N112K probably damaging Het
Trim12c A T 7: 104,341,958 M263K unknown Het
Trim55 A G 3: 19,672,847 I359M probably benign Het
Utp20 A T 10: 88,758,444 W2140R probably benign Het
Vgll3 T C 16: 65,828,078 V104A probably damaging Het
Vmn2r74 C A 7: 85,956,019 G474* probably null Het
Vps18 G A 2: 119,292,756 A98T probably benign Het
Zfand4 T A 6: 116,314,208 S387T probably damaging Het
Zfp808 A G 13: 62,173,120 Y721C probably damaging Het
Other mutations in Gen1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Gen1 APN 12 11261067 missense probably damaging 1.00
IGL01308:Gen1 APN 12 11256870 missense probably damaging 1.00
IGL01384:Gen1 APN 12 11255241 missense probably benign 0.00
IGL01766:Gen1 APN 12 11256894 missense probably damaging 1.00
IGL02132:Gen1 APN 12 11241866 missense probably benign 0.37
IGL02191:Gen1 APN 12 11242296 missense probably benign 0.18
IGL02452:Gen1 APN 12 11242575 missense probably benign 0.02
IGL02479:Gen1 APN 12 11241935 missense probably benign 0.01
IGL02690:Gen1 APN 12 11241575 missense probably damaging 0.96
IGL03095:Gen1 APN 12 11248264 missense probably benign 0.38
PIT4520001:Gen1 UTSW 12 11241508 missense probably benign 0.12
R0014:Gen1 UTSW 12 11241641 missense probably benign 0.44
R0014:Gen1 UTSW 12 11241641 missense probably benign 0.44
R0355:Gen1 UTSW 12 11248354 splice site probably benign
R0680:Gen1 UTSW 12 11241869 missense probably benign 0.06
R0891:Gen1 UTSW 12 11248354 splice site probably benign
R1192:Gen1 UTSW 12 11255218 missense probably damaging 0.97
R1353:Gen1 UTSW 12 11243219 missense probably benign 0.00
R1833:Gen1 UTSW 12 11248351 splice site probably benign
R1898:Gen1 UTSW 12 11241608 missense probably benign 0.10
R2138:Gen1 UTSW 12 11241621 missense probably damaging 1.00
R2185:Gen1 UTSW 12 11261040 missense probably null 0.95
R2409:Gen1 UTSW 12 11249164 missense possibly damaging 0.75
R2876:Gen1 UTSW 12 11242068 missense probably benign 0.13
R3815:Gen1 UTSW 12 11252033 missense possibly damaging 0.84
R4402:Gen1 UTSW 12 11242362 missense possibly damaging 0.71
R4572:Gen1 UTSW 12 11242418 missense probably damaging 0.99
R4900:Gen1 UTSW 12 11241560 missense probably benign 0.00
R5091:Gen1 UTSW 12 11246346 missense probably damaging 0.97
R5952:Gen1 UTSW 12 11260896 missense probably damaging 0.96
R6785:Gen1 UTSW 12 11262530 missense possibly damaging 0.89
R6869:Gen1 UTSW 12 11241441 missense probably benign 0.02
R7057:Gen1 UTSW 12 11242418 missense probably benign 0.21
R7155:Gen1 UTSW 12 11241832 missense probably benign 0.25
R7260:Gen1 UTSW 12 11256848 missense probably damaging 0.99
R7316:Gen1 UTSW 12 11241469 missense probably benign
R7512:Gen1 UTSW 12 11260976 missense possibly damaging 0.79
R7692:Gen1 UTSW 12 11242166 missense probably benign 0.22
R7800:Gen1 UTSW 12 11241862 missense probably benign 0.00
R8061:Gen1 UTSW 12 11261076 splice site probably benign
R8112:Gen1 UTSW 12 11254373 nonsense probably null
R8152:Gen1 UTSW 12 11243265 missense probably damaging 0.99
R8153:Gen1 UTSW 12 11260947 missense probably damaging 1.00
R8161:Gen1 UTSW 12 11241464 missense probably benign 0.21
R8942:Gen1 UTSW 12 11242286 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACGCATGTCAATGTCTTCTG -3'
(R):5'- AGCTAGGCTTGGATCGAGAC -3'

Sequencing Primer
(F):5'- AAGCTGTAGGATTGTTCACTGACTC -3'
(R):5'- ATCGAGACGCTCTGGTTGGAC -3'
Posted On2020-08-07