Incidental Mutation 'R7924:G530012D18Rik'
ID 643171
Institutional Source Beutler Lab
Gene Symbol G530012D18Rik
Ensembl Gene ENSMUSG00000094127
Gene Name RIKEN cDNA G530012D1 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock # R7924 (G1)
Quality Score 333.242
Status Validated
Chromosome 1
Chromosomal Location 85575676-85577295 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 85577214 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 113 (D113E)
Ref Sequence ENSEMBL: ENSMUSP00000136816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093508] [ENSMUST00000178024]
AlphaFold J3QK25
Predicted Effect probably benign
Transcript: ENSMUST00000093508
SMART Domains Protein: ENSMUSP00000091226
Gene: ENSMUSG00000070034

DomainStartEndE-ValueType
Pfam:Sp100 8 106 2.3e-41 PFAM
low complexity region 242 254 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
SAND 360 433 3.55e-28 SMART
Predicted Effect unknown
Transcript: ENSMUST00000178024
AA Change: D113E
SMART Domains Protein: ENSMUSP00000136816
Gene: ENSMUSG00000094127
AA Change: D113E

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 82 122 N/A INTRINSIC
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 99% (78/79)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik T A 8: 124,663,312 probably benign Het
4930435E12Rik G A 16: 38,812,464 Q369* probably null Het
Acacb A G 5: 114,245,220 K2155E possibly damaging Het
Adgre5 G A 8: 83,729,400 P256S possibly damaging Het
Adipor1 T A 1: 134,425,993 V172D probably damaging Het
Ahsa1 T C 12: 87,270,456 probably null Het
Ankrd11 T C 8: 122,895,902 I404V possibly damaging Het
Asxl3 G A 18: 22,525,545 R2204Q probably damaging Het
Barhl2 A G 5: 106,457,649 S65P unknown Het
Bbx A T 16: 50,224,308 L630H probably damaging Het
Cars T C 7: 143,569,871 T531A possibly damaging Het
Catsperb T A 12: 101,520,565 H450Q probably benign Het
Cdt1 T C 8: 122,569,352 L135P probably damaging Het
Cemip A T 7: 83,943,715 probably benign Het
Cfap206 T A 4: 34,728,833 H24L probably benign Het
Cnga4 T A 7: 105,407,821 V480E probably benign Het
Cnot1 ACG A 8: 95,745,647 probably null Het
Ctcfl G A 2: 173,113,656 T271I possibly damaging Het
Dlc1 T C 8: 36,571,416 R1003G probably benign Het
Dnah7b A G 1: 46,219,430 D1927G probably benign Het
Dscc1 A T 15: 55,082,176 D374E probably benign Het
Eci2 G A 13: 34,993,070 Q69* probably null Het
Ep300 C A 15: 81,649,502 P1920Q unknown Het
Epha5 A G 5: 84,084,846 Y629H possibly damaging Het
Fam208b A T 13: 3,594,331 F129Y possibly damaging Het
Fat2 G A 11: 55,262,787 T3533I probably benign Het
Fat3 T C 9: 15,999,297 N1803S probably damaging Het
Fcrls T C 3: 87,259,533 Y51C probably damaging Het
Gcnt2 A T 13: 40,918,564 K228* probably null Het
Gucy2c A T 6: 136,763,055 V258E probably benign Het
Hecw1 C A 13: 14,322,528 L298F probably damaging Het
Hydin T G 8: 110,418,471 V818G possibly damaging Het
Hykk A G 9: 54,922,240 Y131C probably damaging Het
Ick T C 9: 78,155,464 L260P probably damaging Het
Mpo A G 11: 87,794,840 D48G probably damaging Het
Mrps10 T C 17: 47,378,283 *202Q probably null Het
Mrps14 T C 1: 160,196,989 V30A probably benign Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Muc2 G T 7: 141,695,388 G497W probably damaging Het
Nnt A T 13: 119,386,645 V237D probably damaging Het
Nox4 G T 7: 87,374,381 V492L probably benign Het
Obscn C G 11: 59,112,555 E1306Q probably benign Het
Olfr303 A G 7: 86,394,730 I256T probably damaging Het
Olfr993 T C 2: 85,414,219 Y220C probably benign Het
Pard3 A G 8: 127,410,750 N861S probably benign Het
Pdlim4 G A 11: 54,055,222 R230* probably null Het
Pinlyp C T 7: 24,542,125 V159M possibly damaging Het
Pla2g4d T C 2: 120,289,164 probably benign Het
Plcb1 A T 2: 135,359,693 T855S probably benign Het
Pot1a T A 6: 25,753,310 D409V possibly damaging Het
Prom1 T C 5: 44,029,769 D382G probably benign Het
Prss16 A T 13: 22,008,664 N83K probably damaging Het
Ptprn2 A G 12: 116,841,264 D133G probably benign Het
Rasef C T 4: 73,740,929 probably null Het
Rbak A G 5: 143,174,486 S271P probably damaging Het
Rbm20 A T 19: 53,677,585 I60F possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rsf1 G GACGGCCGCC 7: 97,579,909 probably benign Het
Serpinb3c A G 1: 107,273,174 L171P probably damaging Het
Slc25a19 T C 11: 115,615,550 Y211C unknown Het
Sorbs2 C T 8: 45,795,470 S586L probably damaging Het
Spesp1 A T 9: 62,273,451 S58R probably benign Het
Spryd3 A G 15: 102,118,327 I329T probably benign Het
St8sia2 G A 7: 73,966,952 L113F probably damaging Het
Star T C 8: 25,809,855 I75T possibly damaging Het
Tdrd6 T A 17: 43,627,806 I784F possibly damaging Het
Tsc22d4 A G 5: 137,768,011 I144V unknown Het
Tspan8 T C 10: 115,833,324 probably null Het
Ttll9 C T 2: 152,962,487 probably benign Het
Ttn T C 2: 76,809,850 probably benign Het
Ubr4 T G 4: 139,467,276 L1160R unknown Het
Ufd1 A G 16: 18,823,285 Y162C possibly damaging Het
Unc13c A T 9: 73,734,408 F1268I probably benign Het
Uvssa T C 5: 33,410,951 I561T probably damaging Het
Vmn2r15 A T 5: 109,286,388 S817T probably damaging Het
Ybx1 T C 4: 119,282,279 E173G probably damaging Het
Zc3h6 T C 2: 129,015,480 S640P possibly damaging Het
Other mutations in G530012D18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB001:G530012D18Rik UTSW 1 85577214 missense unknown
BB003:G530012D18Rik UTSW 1 85577214 missense unknown
BB005:G530012D18Rik UTSW 1 85577214 missense unknown
BB006:G530012D18Rik UTSW 1 85577214 missense unknown
BB011:G530012D18Rik UTSW 1 85577214 missense unknown
BB013:G530012D18Rik UTSW 1 85577214 missense unknown
BB015:G530012D18Rik UTSW 1 85577214 missense unknown
BB016:G530012D18Rik UTSW 1 85577214 missense unknown
FR4340:G530012D18Rik UTSW 1 85577152 small deletion probably benign
FR4449:G530012D18Rik UTSW 1 85577180 small deletion probably benign
FR4737:G530012D18Rik UTSW 1 85577178 frame shift probably null
IGL03050:G530012D18Rik UTSW 1 85577224 frame shift probably null
PIT4142001:G530012D18Rik UTSW 1 85577204 utr 3 prime probably benign
R0707:G530012D18Rik UTSW 1 85577224 frame shift probably null
R0730:G530012D18Rik UTSW 1 85577036 utr 3 prime probably benign
R0819:G530012D18Rik UTSW 1 85577224 frame shift probably null
R1053:G530012D18Rik UTSW 1 85577224 frame shift probably null
R1155:G530012D18Rik UTSW 1 85577224 frame shift probably null
R1236:G530012D18Rik UTSW 1 85577224 frame shift probably null
R1245:G530012D18Rik UTSW 1 85577224 frame shift probably null
R1880:G530012D18Rik UTSW 1 85577224 frame shift probably null
R1961:G530012D18Rik UTSW 1 85577224 frame shift probably null
R2033:G530012D18Rik UTSW 1 85577154 frame shift probably null
R2055:G530012D18Rik UTSW 1 85577224 frame shift probably null
R2510:G530012D18Rik UTSW 1 85577204 utr 3 prime probably benign
R2903:G530012D18Rik UTSW 1 85577224 frame shift probably null
R2989:G530012D18Rik UTSW 1 85577216 frame shift probably null
R3000:G530012D18Rik UTSW 1 85577224 frame shift probably null
R3757:G530012D18Rik UTSW 1 85577224 frame shift probably null
R3914:G530012D18Rik UTSW 1 85577224 frame shift probably null
R4358:G530012D18Rik UTSW 1 85577202 utr 3 prime probably benign
R4407:G530012D18Rik UTSW 1 85577202 utr 3 prime probably benign
R4417:G530012D18Rik UTSW 1 85577202 utr 3 prime probably benign
R5086:G530012D18Rik UTSW 1 85577220 utr 3 prime probably benign
R5389:G530012D18Rik UTSW 1 85577202 utr 3 prime probably benign
R7212:G530012D18Rik UTSW 1 85577143 missense unknown
R7823:G530012D18Rik UTSW 1 85577202 utr 3 prime probably benign
R7926:G530012D18Rik UTSW 1 85577214 missense unknown
R7927:G530012D18Rik UTSW 1 85577214 missense unknown
R7928:G530012D18Rik UTSW 1 85577214 missense unknown
R7929:G530012D18Rik UTSW 1 85577214 missense unknown
R8162:G530012D18Rik UTSW 1 85577214 missense unknown
R8163:G530012D18Rik UTSW 1 85577214 missense unknown
R8164:G530012D18Rik UTSW 1 85577214 missense unknown
R8263:G530012D18Rik UTSW 1 85577214 missense unknown
R8264:G530012D18Rik UTSW 1 85577214 missense unknown
R8265:G530012D18Rik UTSW 1 85577214 missense unknown
R8491:G530012D18Rik UTSW 1 85577214 missense unknown
R8492:G530012D18Rik UTSW 1 85577214 missense unknown
R8524:G530012D18Rik UTSW 1 85577214 missense unknown
R8742:G530012D18Rik UTSW 1 85577214 missense unknown
R8744:G530012D18Rik UTSW 1 85577214 missense unknown
X0023:G530012D18Rik UTSW 1 85577224 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATCGTGAGCGTGTACCACAG -3'
(R):5'- ACAGGTGTTTCCTAAAGGGG -3'

Sequencing Primer
(F):5'- TGTACCACAGTGCTGGGTCAG -3'
(R):5'- GGGGGAAACATCAATATTCACAAG -3'
Posted On 2020-08-07