Incidental Mutation 'R7924:Cfap206'
ID643182
Institutional Source Beutler Lab
Gene Symbol Cfap206
Ensembl Gene ENSMUSG00000028294
Gene Namecilia and flagella associated protein 206
Synonyms1700003M02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.367) question?
Stock #R7924 (G1)
Quality Score999
Status Validated
Chromosome4
Chromosomal Location34688559-34730206 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34728833 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 24 (H24L)
Ref Sequence ENSEMBL: ENSMUSP00000103771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029971] [ENSMUST00000108136] [ENSMUST00000137514] [ENSMUST00000162495]
Predicted Effect probably benign
Transcript: ENSMUST00000029971
AA Change: H24L

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000029971
Gene: ENSMUSG00000028294
AA Change: H24L

DomainStartEndE-ValueType
Pfam:DUF3508 214 491 6.1e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108136
AA Change: H24L

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000103771
Gene: ENSMUSG00000028294
AA Change: H24L

DomainStartEndE-ValueType
Pfam:DUF3508 213 493 3.8e-127 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137514
AA Change: H24L

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect possibly damaging
Transcript: ENSMUST00000162495
AA Change: H24L

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 99% (78/79)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik T A 8: 124,663,312 probably benign Het
4930435E12Rik G A 16: 38,812,464 Q369* probably null Het
Acacb A G 5: 114,245,220 K2155E possibly damaging Het
Adgre5 G A 8: 83,729,400 P256S possibly damaging Het
Adipor1 T A 1: 134,425,993 V172D probably damaging Het
Ahsa1 T C 12: 87,270,456 probably null Het
Ankrd11 T C 8: 122,895,902 I404V possibly damaging Het
Asxl3 G A 18: 22,525,545 R2204Q probably damaging Het
Barhl2 A G 5: 106,457,649 S65P unknown Het
Bbx A T 16: 50,224,308 L630H probably damaging Het
Cars T C 7: 143,569,871 T531A possibly damaging Het
Catsperb T A 12: 101,520,565 H450Q probably benign Het
Cdt1 T C 8: 122,569,352 L135P probably damaging Het
Cemip A T 7: 83,943,715 probably benign Het
Cnga4 T A 7: 105,407,821 V480E probably benign Het
Cnot1 ACG A 8: 95,745,647 probably null Het
Ctcfl G A 2: 173,113,656 T271I possibly damaging Het
Dlc1 T C 8: 36,571,416 R1003G probably benign Het
Dnah7b A G 1: 46,219,430 D1927G probably benign Het
Dscc1 A T 15: 55,082,176 D374E probably benign Het
Eci2 G A 13: 34,993,070 Q69* probably null Het
Ep300 C A 15: 81,649,502 P1920Q unknown Het
Epha5 A G 5: 84,084,846 Y629H possibly damaging Het
Fam208b A T 13: 3,594,331 F129Y possibly damaging Het
Fat2 G A 11: 55,262,787 T3533I probably benign Het
Fat3 T C 9: 15,999,297 N1803S probably damaging Het
Fcrls T C 3: 87,259,533 Y51C probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gcnt2 A T 13: 40,918,564 K228* probably null Het
Gucy2c A T 6: 136,763,055 V258E probably benign Het
Hecw1 C A 13: 14,322,528 L298F probably damaging Het
Hydin T G 8: 110,418,471 V818G possibly damaging Het
Hykk A G 9: 54,922,240 Y131C probably damaging Het
Ick T C 9: 78,155,464 L260P probably damaging Het
Mpo A G 11: 87,794,840 D48G probably damaging Het
Mrps10 T C 17: 47,378,283 *202Q probably null Het
Mrps14 T C 1: 160,196,989 V30A probably benign Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Muc2 G T 7: 141,695,388 G497W probably damaging Het
Nnt A T 13: 119,386,645 V237D probably damaging Het
Nox4 G T 7: 87,374,381 V492L probably benign Het
Obscn C G 11: 59,112,555 E1306Q probably benign Het
Olfr303 A G 7: 86,394,730 I256T probably damaging Het
Olfr993 T C 2: 85,414,219 Y220C probably benign Het
Pard3 A G 8: 127,410,750 N861S probably benign Het
Pdlim4 G A 11: 54,055,222 R230* probably null Het
Pinlyp C T 7: 24,542,125 V159M possibly damaging Het
Pla2g4d T C 2: 120,289,164 probably benign Het
Plcb1 A T 2: 135,359,693 T855S probably benign Het
Pot1a T A 6: 25,753,310 D409V possibly damaging Het
Prom1 T C 5: 44,029,769 D382G probably benign Het
Prss16 A T 13: 22,008,664 N83K probably damaging Het
Ptprn2 A G 12: 116,841,264 D133G probably benign Het
Rasef C T 4: 73,740,929 probably null Het
Rbak A G 5: 143,174,486 S271P probably damaging Het
Rbm20 A T 19: 53,677,585 I60F possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rsf1 G GACGGCCGCC 7: 97,579,909 probably benign Het
Serpinb3c A G 1: 107,273,174 L171P probably damaging Het
Slc25a19 T C 11: 115,615,550 Y211C unknown Het
Sorbs2 C T 8: 45,795,470 S586L probably damaging Het
Spesp1 A T 9: 62,273,451 S58R probably benign Het
Spryd3 A G 15: 102,118,327 I329T probably benign Het
St8sia2 G A 7: 73,966,952 L113F probably damaging Het
Star T C 8: 25,809,855 I75T possibly damaging Het
Tdrd6 T A 17: 43,627,806 I784F possibly damaging Het
Tsc22d4 A G 5: 137,768,011 I144V unknown Het
Tspan8 T C 10: 115,833,324 probably null Het
Ttll9 C T 2: 152,962,487 probably benign Het
Ttn T C 2: 76,809,850 probably benign Het
Ubr4 T G 4: 139,467,276 L1160R unknown Het
Ufd1 A G 16: 18,823,285 Y162C possibly damaging Het
Unc13c A T 9: 73,734,408 F1268I probably benign Het
Uvssa T C 5: 33,410,951 I561T probably damaging Het
Vmn2r15 A T 5: 109,286,388 S817T probably damaging Het
Ybx1 T C 4: 119,282,279 E173G probably damaging Het
Zc3h6 T C 2: 129,015,480 S640P possibly damaging Het
Other mutations in Cfap206
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00797:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL00798:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL00826:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL00919:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01062:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01064:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01069:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01070:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01086:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01087:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01090:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01098:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01111:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01133:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01135:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01147:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01152:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01153:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01154:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01155:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01289:Cfap206 APN 4 34716469 missense probably null 0.98
IGL01845:Cfap206 APN 4 34719610 missense possibly damaging 0.57
IGL02115:Cfap206 APN 4 34722623 missense possibly damaging 0.54
IGL03241:Cfap206 APN 4 34711553 missense probably damaging 1.00
IGL03405:Cfap206 APN 4 34716445 missense possibly damaging 0.82
ANU05:Cfap206 UTSW 4 34721562 missense probably damaging 1.00
BB001:Cfap206 UTSW 4 34728833 missense probably benign 0.10
BB011:Cfap206 UTSW 4 34728833 missense probably benign 0.10
R0012:Cfap206 UTSW 4 34714519 missense possibly damaging 0.76
R0689:Cfap206 UTSW 4 34722668 missense probably benign 0.23
R0730:Cfap206 UTSW 4 34711391 missense probably benign
R1567:Cfap206 UTSW 4 34716490 missense probably benign 0.01
R1694:Cfap206 UTSW 4 34719058 missense probably damaging 1.00
R1706:Cfap206 UTSW 4 34688875 missense probably damaging 1.00
R1837:Cfap206 UTSW 4 34728813 missense probably damaging 1.00
R1909:Cfap206 UTSW 4 34722714 missense probably benign
R2098:Cfap206 UTSW 4 34719053 nonsense probably null
R2568:Cfap206 UTSW 4 34711566 nonsense probably null
R3125:Cfap206 UTSW 4 34716310 missense possibly damaging 0.48
R3784:Cfap206 UTSW 4 34716445 missense probably damaging 0.99
R5249:Cfap206 UTSW 4 34714502 missense probably benign
R5483:Cfap206 UTSW 4 34711404 missense probably benign 0.39
R5569:Cfap206 UTSW 4 34724892 missense probably damaging 1.00
R6247:Cfap206 UTSW 4 34692530 missense probably benign
R6555:Cfap206 UTSW 4 34719049 missense probably damaging 1.00
R6791:Cfap206 UTSW 4 34711414 missense possibly damaging 0.76
R6865:Cfap206 UTSW 4 34714448 missense possibly damaging 0.57
R7164:Cfap206 UTSW 4 34719656 missense probably benign
R7814:Cfap206 UTSW 4 34716347 missense probably benign 0.01
R8092:Cfap206 UTSW 4 34728897 missense possibly damaging 0.62
R8240:Cfap206 UTSW 4 34728902 start codon destroyed probably null 1.00
R8323:Cfap206 UTSW 4 34719647 missense probably benign 0.00
Z1176:Cfap206 UTSW 4 34719661 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGCAGACTCTGAAAAGATGCC -3'
(R):5'- CTCAGTAGACAGTGTGGATATTCC -3'

Sequencing Primer
(F):5'- GAGTACACTGTAGCTGTCTTCAGAC -3'
(R):5'- CTTCATTTAGCCACAATGCC -3'
Posted On2020-08-07