Incidental Mutation 'R7924:Rasef'
ID 643183
Institutional Source Beutler Lab
Gene Symbol Rasef
Ensembl Gene ENSMUSG00000043003
Gene Name RAS and EF hand domain containing
Synonyms RAB45
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock # R7924 (G1)
Quality Score 999
Status Validated
Chromosome 4
Chromosomal Location 73714579-73790994 bp(-) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 73740929 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000062771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058292] [ENSMUST00000102837] [ENSMUST00000222414]
AlphaFold Q5RI75
Predicted Effect probably null
Transcript: ENSMUST00000058292
SMART Domains Protein: ENSMUSP00000062771
Gene: ENSMUSG00000043003

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
coiled coil region 55 251 N/A INTRINSIC
RAB 429 598 4.94e-69 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102837
SMART Domains Protein: ENSMUSP00000099901
Gene: ENSMUSG00000043003

DomainStartEndE-ValueType
coiled coil region 5 179 N/A INTRINSIC
RAB 357 526 4.94e-69 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222414
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Rab family of GTPases that are involved in regulation of membrane traffic. The encoded protein contains an N-terminal EF-hand domain, a coiled-coil motif and a C-terminal Rab domain. A potential role as tumor suppressor has been indicated for this gene. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik T A 8: 124,663,312 probably benign Het
4930435E12Rik G A 16: 38,812,464 Q369* probably null Het
Acacb A G 5: 114,245,220 K2155E possibly damaging Het
Adgre5 G A 8: 83,729,400 P256S possibly damaging Het
Adipor1 T A 1: 134,425,993 V172D probably damaging Het
Ahsa1 T C 12: 87,270,456 probably null Het
Ankrd11 T C 8: 122,895,902 I404V possibly damaging Het
Asxl3 G A 18: 22,525,545 R2204Q probably damaging Het
Barhl2 A G 5: 106,457,649 S65P unknown Het
Bbx A T 16: 50,224,308 L630H probably damaging Het
Cars T C 7: 143,569,871 T531A possibly damaging Het
Catsperb T A 12: 101,520,565 H450Q probably benign Het
Cdt1 T C 8: 122,569,352 L135P probably damaging Het
Cemip A T 7: 83,943,715 probably benign Het
Cfap206 T A 4: 34,728,833 H24L probably benign Het
Cnga4 T A 7: 105,407,821 V480E probably benign Het
Cnot1 ACG A 8: 95,745,647 probably null Het
Ctcfl G A 2: 173,113,656 T271I possibly damaging Het
Dlc1 T C 8: 36,571,416 R1003G probably benign Het
Dnah7b A G 1: 46,219,430 D1927G probably benign Het
Dscc1 A T 15: 55,082,176 D374E probably benign Het
Eci2 G A 13: 34,993,070 Q69* probably null Het
Ep300 C A 15: 81,649,502 P1920Q unknown Het
Epha5 A G 5: 84,084,846 Y629H possibly damaging Het
Fam208b A T 13: 3,594,331 F129Y possibly damaging Het
Fat2 G A 11: 55,262,787 T3533I probably benign Het
Fat3 T C 9: 15,999,297 N1803S probably damaging Het
Fcrls T C 3: 87,259,533 Y51C probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gcnt2 A T 13: 40,918,564 K228* probably null Het
Gucy2c A T 6: 136,763,055 V258E probably benign Het
Hecw1 C A 13: 14,322,528 L298F probably damaging Het
Hydin T G 8: 110,418,471 V818G possibly damaging Het
Hykk A G 9: 54,922,240 Y131C probably damaging Het
Ick T C 9: 78,155,464 L260P probably damaging Het
Mpo A G 11: 87,794,840 D48G probably damaging Het
Mrps10 T C 17: 47,378,283 *202Q probably null Het
Mrps14 T C 1: 160,196,989 V30A probably benign Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Muc2 G T 7: 141,695,388 G497W probably damaging Het
Nnt A T 13: 119,386,645 V237D probably damaging Het
Nox4 G T 7: 87,374,381 V492L probably benign Het
Obscn C G 11: 59,112,555 E1306Q probably benign Het
Olfr303 A G 7: 86,394,730 I256T probably damaging Het
Olfr993 T C 2: 85,414,219 Y220C probably benign Het
Pard3 A G 8: 127,410,750 N861S probably benign Het
Pdlim4 G A 11: 54,055,222 R230* probably null Het
Pinlyp C T 7: 24,542,125 V159M possibly damaging Het
Pla2g4d T C 2: 120,289,164 probably benign Het
Plcb1 A T 2: 135,359,693 T855S probably benign Het
Pot1a T A 6: 25,753,310 D409V possibly damaging Het
Prom1 T C 5: 44,029,769 D382G probably benign Het
Prss16 A T 13: 22,008,664 N83K probably damaging Het
Ptprn2 A G 12: 116,841,264 D133G probably benign Het
Rbak A G 5: 143,174,486 S271P probably damaging Het
Rbm20 A T 19: 53,677,585 I60F possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rsf1 G GACGGCCGCC 7: 97,579,909 probably benign Het
Serpinb3c A G 1: 107,273,174 L171P probably damaging Het
Slc25a19 T C 11: 115,615,550 Y211C unknown Het
Sorbs2 C T 8: 45,795,470 S586L probably damaging Het
Spesp1 A T 9: 62,273,451 S58R probably benign Het
Spryd3 A G 15: 102,118,327 I329T probably benign Het
St8sia2 G A 7: 73,966,952 L113F probably damaging Het
Star T C 8: 25,809,855 I75T possibly damaging Het
Tdrd6 T A 17: 43,627,806 I784F possibly damaging Het
Tsc22d4 A G 5: 137,768,011 I144V unknown Het
Tspan8 T C 10: 115,833,324 probably null Het
Ttll9 C T 2: 152,962,487 probably benign Het
Ttn T C 2: 76,809,850 probably benign Het
Ubr4 T G 4: 139,467,276 L1160R unknown Het
Ufd1 A G 16: 18,823,285 Y162C possibly damaging Het
Unc13c A T 9: 73,734,408 F1268I probably benign Het
Uvssa T C 5: 33,410,951 I561T probably damaging Het
Vmn2r15 A T 5: 109,286,388 S817T probably damaging Het
Ybx1 T C 4: 119,282,279 E173G probably damaging Het
Zc3h6 T C 2: 129,015,480 S640P possibly damaging Het
Other mutations in Rasef
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Rasef APN 4 73771425 nonsense probably null
IGL01329:Rasef APN 4 73727645 missense probably damaging 1.00
IGL01517:Rasef APN 4 73769822 missense probably benign 0.03
IGL02465:Rasef APN 4 73734488 missense probably damaging 1.00
IGL02676:Rasef APN 4 73759729 missense possibly damaging 0.69
IGL03137:Rasef APN 4 73734483 nonsense probably null
IGL03403:Rasef APN 4 73734534 missense probably damaging 1.00
BB001:Rasef UTSW 4 73740929 critical splice donor site probably null
BB011:Rasef UTSW 4 73740929 critical splice donor site probably null
P0033:Rasef UTSW 4 73749852 missense probably benign 0.26
R0035:Rasef UTSW 4 73762854 splice site probably benign
R0035:Rasef UTSW 4 73762854 splice site probably benign
R0317:Rasef UTSW 4 73748562 missense probably damaging 1.00
R0686:Rasef UTSW 4 73734534 missense probably damaging 1.00
R0987:Rasef UTSW 4 73734484 nonsense probably null
R1115:Rasef UTSW 4 73748604 missense possibly damaging 0.85
R1511:Rasef UTSW 4 73735748 missense probably damaging 1.00
R1585:Rasef UTSW 4 73740337 missense probably damaging 1.00
R1646:Rasef UTSW 4 73734549 missense probably damaging 1.00
R1705:Rasef UTSW 4 73744064 nonsense probably null
R1918:Rasef UTSW 4 73744114 missense possibly damaging 0.94
R1919:Rasef UTSW 4 73744114 missense possibly damaging 0.94
R3819:Rasef UTSW 4 73759705 missense probably damaging 1.00
R3891:Rasef UTSW 4 73780397 missense probably benign 0.03
R3892:Rasef UTSW 4 73780397 missense probably benign 0.03
R4344:Rasef UTSW 4 73745089 missense probably damaging 1.00
R4491:Rasef UTSW 4 73734503 missense probably damaging 1.00
R4492:Rasef UTSW 4 73734503 missense probably damaging 1.00
R4594:Rasef UTSW 4 73780389 missense possibly damaging 0.47
R4915:Rasef UTSW 4 73731459 missense probably damaging 1.00
R5276:Rasef UTSW 4 73735767 missense probably null 1.00
R5359:Rasef UTSW 4 73771328 missense probably damaging 1.00
R5682:Rasef UTSW 4 73740971 nonsense probably null
R5693:Rasef UTSW 4 73769839 missense probably damaging 0.99
R6414:Rasef UTSW 4 73740581 missense probably benign 0.13
R6543:Rasef UTSW 4 73780519 intron probably benign
R6593:Rasef UTSW 4 73745090 missense probably damaging 1.00
R7078:Rasef UTSW 4 73780389 missense probably benign 0.01
R7083:Rasef UTSW 4 73790984 missense probably benign 0.26
R7106:Rasef UTSW 4 73727627 missense probably damaging 1.00
R7127:Rasef UTSW 4 73744132 missense probably damaging 1.00
R7329:Rasef UTSW 4 73744137 missense probably damaging 1.00
R7767:Rasef UTSW 4 73734534 missense probably damaging 1.00
R7891:Rasef UTSW 4 73759698 missense probably benign 0.00
R7891:Rasef UTSW 4 73790964 missense probably benign
R7997:Rasef UTSW 4 73740562 missense possibly damaging 0.78
R8554:Rasef UTSW 4 73727607 missense probably benign 0.03
R8832:Rasef UTSW 4 73780321 intron probably benign
R8850:Rasef UTSW 4 73727603 missense probably damaging 1.00
R8985:Rasef UTSW 4 73790723 missense possibly damaging 0.48
R9093:Rasef UTSW 4 73780346 missense probably benign 0.00
R9179:Rasef UTSW 4 73744119 missense probably damaging 0.97
R9199:Rasef UTSW 4 73740388 missense possibly damaging 0.88
R9300:Rasef UTSW 4 73741156 missense probably benign
R9310:Rasef UTSW 4 73735719 critical splice donor site probably null
R9415:Rasef UTSW 4 73727645 missense probably benign 0.00
R9482:Rasef UTSW 4 73790696 missense probably benign 0.00
R9719:Rasef UTSW 4 73769865 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CTGAGTGTACTGCCAGTGTG -3'
(R):5'- TGTGACCCTCTGCAGAAGATG -3'

Sequencing Primer
(F):5'- GTGTGGTTACTAAGCAGACTCCC -3'
(R):5'- GAATTATGAAGTTGACAGCCTGCC -3'
Posted On 2020-08-07