Mutagenetix > Incidental Mutations

Incidental Mutation 'R7924:Acacb'

643191

Institutional Source

Beutler Lab

Gene Symbol

Acacb

Ensembl Gene

ENSMUSG00000042010

Gene Name

acetyl-Coenzyme A carboxylase beta

Synonyms

Acc2, Accb

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7924 (G1)

Quality Score

999

Status

Validated

Chromosome

Chromosomal Location

114146535-114250761 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 114245220 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 2155 (K2155E)

Ref Sequence

ENSEMBL: ENSMUSP00000031583 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031583
AA Change: K2155E

PolyPhen 2 Score 0.631 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: K2155E

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	2.1e-32	PFAM
Pfam:CPSase_L_D2	405	606	3.3e-52	PFAM
Pfam:ATP-grasp_4	413	576	2.1e-9	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	1.9e-17	PFAM
Pfam:ACC_central	952	1678	2.2e-290	PFAM
Pfam:Carboxyl_trans	1770	2324	2.3e-181	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102582
AA Change: K2155E

PolyPhen 2 Score 0.631 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: K2155E

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	8.2e-29	PFAM
Pfam:CPSase_L_D2	405	606	3.8e-52	PFAM
Pfam:ATP-grasp_4	409	576	1.4e-12	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	9.1e-17	PFAM
Pfam:ACC_central	952	1678	2.3e-250	PFAM
Pfam:Carboxyl_trans	1770	2324	4.8e-172	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.7%

Validation Efficiency

99% (78/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022B05Rik	T	A	8: 124,663,312		probably benign	Het
4930435E12Rik	G	A	16: 38,812,464	Q369*	probably null	Het
Adgre5	G	A	8: 83,729,400	P256S	possibly damaging	Het
Adipor1	T	A	1: 134,425,993	V172D	probably damaging	Het
Ahsa1	T	C	12: 87,270,456		probably null	Het
Ankrd11	T	C	8: 122,895,902	I404V	possibly damaging	Het
Asxl3	G	A	18: 22,525,545	R2204Q	probably damaging	Het
Barhl2	A	G	5: 106,457,649	S65P	unknown	Het
Bbx	A	T	16: 50,224,308	L630H	probably damaging	Het
Cars	T	C	7: 143,569,871	T531A	possibly damaging	Het
Catsperb	T	A	12: 101,520,565	H450Q	probably benign	Het
Cdt1	T	C	8: 122,569,352	L135P	probably damaging	Het
Cemip	A	T	7: 83,943,715		probably benign	Het
Cfap206	T	A	4: 34,728,833	H24L	probably benign	Het
Cnga4	T	A	7: 105,407,821	V480E	probably benign	Het
Cnot1	ACG	A	8: 95,745,647		probably null	Het
Ctcfl	G	A	2: 173,113,656	T271I	possibly damaging	Het
Dlc1	T	C	8: 36,571,416	R1003G	probably benign	Het
Dnah7b	A	G	1: 46,219,430	D1927G	probably benign	Het
Dscc1	A	T	15: 55,082,176	D374E	probably benign	Het
Eci2	G	A	13: 34,993,070	Q69*	probably null	Het
Ep300	C	A	15: 81,649,502	P1920Q	unknown	Het
Epha5	A	G	5: 84,084,846	Y629H	possibly damaging	Het
Fam208b	A	T	13: 3,594,331	F129Y	possibly damaging	Het
Fat2	G	A	11: 55,262,787	T3533I	probably benign	Het
Fat3	T	C	9: 15,999,297	N1803S	probably damaging	Het
Fcrls	T	C	3: 87,259,533	Y51C	probably damaging	Het
G530012D18Rik	C	G	1: 85,577,214	D113E	unknown	Het
Gcnt2	A	T	13: 40,918,564	K228*	probably null	Het
Gucy2c	A	T	6: 136,763,055	V258E	probably benign	Het
Hecw1	C	A	13: 14,322,528	L298F	probably damaging	Het
Hydin	T	G	8: 110,418,471	V818G	possibly damaging	Het
Hykk	A	G	9: 54,922,240	Y131C	probably damaging	Het
Ick	T	C	9: 78,155,464	L260P	probably damaging	Het
Mpo	A	G	11: 87,794,840	D48G	probably damaging	Het
Mrps10	T	C	17: 47,378,283	*202Q	probably null	Het
Mrps14	T	C	1: 160,196,989	V30A	probably benign	Het
Mtmr7	G	A	8: 40,606,884	A62V	possibly damaging	Het
Muc2	G	T	7: 141,695,388	G497W	probably damaging	Het
Nnt	A	T	13: 119,386,645	V237D	probably damaging	Het
Nox4	G	T	7: 87,374,381	V492L	probably benign	Het
Obscn	C	G	11: 59,112,555	E1306Q	probably benign	Het
Olfr303	A	G	7: 86,394,730	I256T	probably damaging	Het
Olfr993	T	C	2: 85,414,219	Y220C	probably benign	Het
Pard3	A	G	8: 127,410,750	N861S	probably benign	Het
Pdlim4	G	A	11: 54,055,222	R230*	probably null	Het
Pinlyp	C	T	7: 24,542,125	V159M	possibly damaging	Het
Pla2g4d	T	C	2: 120,289,164		probably benign	Het
Plcb1	A	T	2: 135,359,693	T855S	probably benign	Het
Pot1a	T	A	6: 25,753,310	D409V	possibly damaging	Het
Prom1	T	C	5: 44,029,769	D382G	probably benign	Het
Prss16	A	T	13: 22,008,664	N83K	probably damaging	Het
Ptprn2	A	G	12: 116,841,264	D133G	probably benign	Het
Rasef	C	T	4: 73,740,929		probably null	Het
Rbak	A	G	5: 143,174,486	S271P	probably damaging	Het
Rbm20	A	T	19: 53,677,585	I60F	possibly damaging	Het
Rftn1	G	T	17: 50,047,380	A318D	probably damaging	Het
Rsf1	G	GACGGCCGCC	7: 97,579,909		probably benign	Het
Serpinb3c	A	G	1: 107,273,174	L171P	probably damaging	Het
Slc25a19	T	C	11: 115,615,550	Y211C	unknown	Het
Sorbs2	C	T	8: 45,795,470	S586L	probably damaging	Het
Spesp1	A	T	9: 62,273,451	S58R	probably benign	Het
Spryd3	A	G	15: 102,118,327	I329T	probably benign	Het
St8sia2	G	A	7: 73,966,952	L113F	probably damaging	Het
Star	T	C	8: 25,809,855	I75T	possibly damaging	Het
Tdrd6	T	A	17: 43,627,806	I784F	possibly damaging	Het
Tsc22d4	A	G	5: 137,768,011	I144V	unknown	Het
Tspan8	T	C	10: 115,833,324		probably null	Het
Ttll9	C	T	2: 152,962,487		probably benign	Het
Ttn	T	C	2: 76,809,850		probably benign	Het
Ubr4	T	G	4: 139,467,276	L1160R	unknown	Het
Ufd1	A	G	16: 18,823,285	Y162C	possibly damaging	Het
Unc13c	A	T	9: 73,734,408	F1268I	probably benign	Het
Uvssa	T	C	5: 33,410,951	I561T	probably damaging	Het
Vmn2r15	A	T	5: 109,286,388	S817T	probably damaging	Het
Ybx1	T	C	4: 119,282,279	E173G	probably damaging	Het
Zc3h6	T	C	2: 129,015,480	S640P	possibly damaging	Het

Other mutations in Acacb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Acacb	APN	5	114200289	missense	probably damaging	1.00
IGL01291:Acacb	APN	5	114225870	missense	probably benign	0.03
IGL01301:Acacb	APN	5	114246498	missense	probably benign
IGL01633:Acacb	APN	5	114218858	splice site	probably benign
IGL01736:Acacb	APN	5	114188442	missense	possibly damaging	0.96
IGL01782:Acacb	APN	5	114200520	missense	probably damaging	1.00
IGL01924:Acacb	APN	5	114223986	splice site	probably benign
IGL01933:Acacb	APN	5	114184190	splice site	probably benign
IGL02028:Acacb	APN	5	114166015	missense	probably damaging	1.00
IGL02045:Acacb	APN	5	114240660	missense	possibly damaging	0.95
IGL02346:Acacb	APN	5	114238699	missense	probably damaging	1.00
IGL02421:Acacb	APN	5	114223878	missense	probably benign	0.00
IGL02445:Acacb	APN	5	114245137	missense	probably damaging	1.00
IGL02491:Acacb	APN	5	114192105	missense	probably damaging	1.00
IGL02598:Acacb	APN	5	114246037	missense	probably damaging	1.00
IGL02700:Acacb	APN	5	114218881	missense	probably damaging	1.00
IGL02730:Acacb	APN	5	114166149	splice site	probably benign
IGL03110:Acacb	APN	5	114195234	missense	probably damaging	0.96
IGL03125:Acacb	APN	5	114204805	missense	possibly damaging	0.49
IGL03263:Acacb	APN	5	114213693	missense	probably damaging	1.00
IGL03324:Acacb	APN	5	114225854	nonsense	probably null
ANU05:Acacb	UTSW	5	114225870	missense	probably benign	0.03
ANU18:Acacb	UTSW	5	114246498	missense	probably benign
BB001:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
BB011:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
I0000:Acacb	UTSW	5	114238655	missense	probably damaging	0.99
R0001:Acacb	UTSW	5	114204833	splice site	probably benign
R0219:Acacb	UTSW	5	114232944	missense	possibly damaging	0.79
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0278:Acacb	UTSW	5	114233259	nonsense	probably null
R0607:Acacb	UTSW	5	114200301	missense	probably damaging	1.00
R0964:Acacb	UTSW	5	114229752	missense	possibly damaging	0.64
R1116:Acacb	UTSW	5	114210956	missense	probably damaging	1.00
R1196:Acacb	UTSW	5	114245092	missense	probably benign	0.00
R1204:Acacb	UTSW	5	114190153	missense	probably damaging	1.00
R1387:Acacb	UTSW	5	114200512	missense	probably benign
R1415:Acacb	UTSW	5	114165921	missense	probably benign
R1475:Acacb	UTSW	5	114195252	missense	possibly damaging	0.87
R1497:Acacb	UTSW	5	114196807	missense	probably damaging	1.00
R1520:Acacb	UTSW	5	114201940	missense	possibly damaging	0.67
R1591:Acacb	UTSW	5	114203423	missense	possibly damaging	0.87
R1644:Acacb	UTSW	5	114195285	missense	probably damaging	1.00
R1732:Acacb	UTSW	5	114190087	missense	possibly damaging	0.63
R1783:Acacb	UTSW	5	114209767	frame shift	probably null
R1784:Acacb	UTSW	5	114209767	frame shift	probably null
R1834:Acacb	UTSW	5	114235475	missense	probably damaging	1.00
R1858:Acacb	UTSW	5	114196709	missense	probably benign	0.13
R1886:Acacb	UTSW	5	114218959	missense	probably damaging	1.00
R1901:Acacb	UTSW	5	114165734	nonsense	probably null
R1902:Acacb	UTSW	5	114165734	nonsense	probably null
R1903:Acacb	UTSW	5	114165734	nonsense	probably null
R1924:Acacb	UTSW	5	114230720	missense	possibly damaging	0.67
R1934:Acacb	UTSW	5	114198282	missense	probably benign	0.27
R2051:Acacb	UTSW	5	114245890	missense	probably damaging	1.00
R2132:Acacb	UTSW	5	114209767	frame shift	probably null
R2133:Acacb	UTSW	5	114209767	frame shift	probably null
R2260:Acacb	UTSW	5	114216917	missense	probably damaging	0.99
R2967:Acacb	UTSW	5	114166070	missense	possibly damaging	0.81
R3421:Acacb	UTSW	5	114212636	splice site	probably null
R3729:Acacb	UTSW	5	114207348	missense	probably damaging	0.99
R4206:Acacb	UTSW	5	114213651	missense	probably benign
R4245:Acacb	UTSW	5	114230784	missense	probably damaging	0.97
R4386:Acacb	UTSW	5	114241921	critical splice acceptor site	probably null
R4439:Acacb	UTSW	5	114246496	missense	possibly damaging	0.50
R4577:Acacb	UTSW	5	114226831	missense	probably damaging	1.00
R4658:Acacb	UTSW	5	114200564	missense	probably damaging	0.96
R4688:Acacb	UTSW	5	114204763	missense	probably benign	0.01
R4720:Acacb	UTSW	5	114229914	missense	possibly damaging	0.73
R4898:Acacb	UTSW	5	114232938	missense	probably benign	0.04
R5044:Acacb	UTSW	5	114166027	missense	probably benign	0.03
R5070:Acacb	UTSW	5	114246028	missense	possibly damaging	0.46
R5294:Acacb	UTSW	5	114241952	missense	probably damaging	1.00
R5350:Acacb	UTSW	5	114244551	missense	probably damaging	1.00
R5401:Acacb	UTSW	5	114209853	missense	possibly damaging	0.80
R5531:Acacb	UTSW	5	114204706	missense	possibly damaging	0.92
R5542:Acacb	UTSW	5	114195737	missense	probably damaging	1.00
R5751:Acacb	UTSW	5	114230832	missense	possibly damaging	0.79
R5821:Acacb	UTSW	5	114184106	missense	possibly damaging	0.69
R5893:Acacb	UTSW	5	114229851	missense	probably benign	0.01
R5911:Acacb	UTSW	5	114232890	missense	probably damaging	0.97
R5944:Acacb	UTSW	5	114245980	missense	probably damaging	1.00
R5973:Acacb	UTSW	5	114226867	missense	probably damaging	1.00
R6027:Acacb	UTSW	5	114165600	missense	probably benign	0.43
R6103:Acacb	UTSW	5	114245881	missense	probably damaging	1.00
R6139:Acacb	UTSW	5	114212652	missense	probably damaging	1.00
R6292:Acacb	UTSW	5	114200251	missense	probably damaging	1.00
R6368:Acacb	UTSW	5	114216823	missense	probably damaging	0.98
R6429:Acacb	UTSW	5	114228591	missense	probably damaging	1.00
R6942:Acacb	UTSW	5	114191963	critical splice donor site	probably null
R7138:Acacb	UTSW	5	114207326	missense	probably benign	0.12
R7241:Acacb	UTSW	5	114245100	missense	possibly damaging	0.94
R7254:Acacb	UTSW	5	114209751	critical splice acceptor site	probably null
R7396:Acacb	UTSW	5	114213661	missense	possibly damaging	0.87
R7439:Acacb	UTSW	5	114195642	missense	possibly damaging	0.84
R7484:Acacb	UTSW	5	114218862	missense	probably damaging	1.00
R7585:Acacb	UTSW	5	114246012	missense	probably damaging	0.99
R7712:Acacb	UTSW	5	114165738	missense	probably benign	0.13
R7868:Acacb	UTSW	5	114248227	missense	probably benign	0.22
R7873:Acacb	UTSW	5	114223278	missense	possibly damaging	0.88
R7940:Acacb	UTSW	5	114166047	missense	possibly damaging	0.77
R7951:Acacb	UTSW	5	114188340	missense	probably damaging	1.00
R7960:Acacb	UTSW	5	114230861	missense	probably benign	0.00
R7972:Acacb	UTSW	5	114226857	nonsense	probably null
R8007:Acacb	UTSW	5	114218874	missense	probably damaging	0.97
R8022:Acacb	UTSW	5	114223854	missense	probably benign
R8030:Acacb	UTSW	5	114233167	missense	probably damaging	1.00
R8241:Acacb	UTSW	5	114195236	missense	possibly damaging	0.49
R8264:Acacb	UTSW	5	114207366	missense	probably benign	0.00
R8292:Acacb	UTSW	5	114200494	critical splice acceptor site	probably null
V1662:Acacb	UTSW	5	114238708	missense	probably damaging	1.00
Z1176:Acacb	UTSW	5	114248948	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CCTAAGGTTATGGCCATGCTTTG -3'
(R):5'- TCAGCTCTGAGGAAGGTGGATG -3'

Sequencing Primer
(F):5'- CACTGTTCATCGCTGAAGGAAGTC -3'
(R):5'- TGGATGGACATACGCCTTCC -3'

Posted On

2020-08-07