Incidental Mutation 'R7924:Pot1a'
ID 643194
Institutional Source Beutler Lab
Gene Symbol Pot1a
Ensembl Gene ENSMUSG00000029676
Gene Name protection of telomeres 1A
Synonyms 1500031H18Rik, Pot1
MMRRC Submission 045971-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7924 (G1)
Quality Score 999
Status Validated
Chromosome 6
Chromosomal Location 25743939-25809280 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 25753309 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 409 (D409V)
Ref Sequence ENSEMBL: ENSMUSP00000110986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115327] [ENSMUST00000115330] [ENSMUST00000166445]
AlphaFold Q91WC1
Predicted Effect probably benign
Transcript: ENSMUST00000115327
SMART Domains Protein: ENSMUSP00000110982
Gene: ENSMUSG00000029676

DomainStartEndE-ValueType
Telo_bind 11 141 3.6e-53 SMART
low complexity region 253 260 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115330
AA Change: D409V

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110986
Gene: ENSMUSG00000029676
AA Change: D409V

DomainStartEndE-ValueType
Telo_bind 11 141 3.6e-53 SMART
Pfam:POT1PC 152 299 6.7e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000166445
AA Change: D409V

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131928
Gene: ENSMUSG00000029676
AA Change: D409V

DomainStartEndE-ValueType
Telo_bind 11 141 3.6e-53 SMART
low complexity region 253 260 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere length and protecting chromosome ends from illegitimate recombination, catastrophic chromosome instability, and abnormal chromosome segregation. Increased transcriptional expression of this gene is associated with stomach carcinogenesis and its progression. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to complete prenatal lethality. Embryos homozygous for a gene trapped allele fail to form an inner cell mass in culture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik T A 8: 125,390,051 (GRCm39) probably benign Het
Acacb A G 5: 114,383,281 (GRCm39) K2155E possibly damaging Het
Adgre5 G A 8: 84,456,029 (GRCm39) P256S possibly damaging Het
Adipor1 T A 1: 134,353,731 (GRCm39) V172D probably damaging Het
Ahsa1 T C 12: 87,317,230 (GRCm39) probably null Het
Ankrd11 T C 8: 123,622,641 (GRCm39) I404V possibly damaging Het
Asxl3 G A 18: 22,658,602 (GRCm39) R2204Q probably damaging Het
Barhl2 A G 5: 106,605,515 (GRCm39) S65P unknown Het
Bbx A T 16: 50,044,671 (GRCm39) L630H probably damaging Het
Cars1 T C 7: 143,123,608 (GRCm39) T531A possibly damaging Het
Catsperb T A 12: 101,486,824 (GRCm39) H450Q probably benign Het
Cdt1 T C 8: 123,296,091 (GRCm39) L135P probably damaging Het
Cemip A T 7: 83,592,923 (GRCm39) probably benign Het
Cfap206 T A 4: 34,728,833 (GRCm39) H24L probably benign Het
Cilk1 T C 9: 78,062,746 (GRCm39) L260P probably damaging Het
Cnga4 T A 7: 105,057,028 (GRCm39) V480E probably benign Het
Cnot1 ACG A 8: 96,472,275 (GRCm39) probably null Het
Ctcfl G A 2: 172,955,449 (GRCm39) T271I possibly damaging Het
Dlc1 T C 8: 37,038,570 (GRCm39) R1003G probably benign Het
Dnah7b A G 1: 46,258,590 (GRCm39) D1927G probably benign Het
Dscc1 A T 15: 54,945,572 (GRCm39) D374E probably benign Het
Eci2 G A 13: 35,177,053 (GRCm39) Q69* probably null Het
Ep300 C A 15: 81,533,703 (GRCm39) P1920Q unknown Het
Epha5 A G 5: 84,232,705 (GRCm39) Y629H possibly damaging Het
Fat2 G A 11: 55,153,613 (GRCm39) T3533I probably benign Het
Fat3 T C 9: 15,910,593 (GRCm39) N1803S probably damaging Het
Fcrl2 T C 3: 87,166,840 (GRCm39) Y51C probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Gcnt2 A T 13: 41,072,040 (GRCm39) K228* probably null Het
Gucy2c A T 6: 136,740,053 (GRCm39) V258E probably benign Het
Hecw1 C A 13: 14,497,113 (GRCm39) L298F probably damaging Het
Hydin T G 8: 111,145,103 (GRCm39) V818G possibly damaging Het
Hykk A G 9: 54,829,524 (GRCm39) Y131C probably damaging Het
Mpo A G 11: 87,685,666 (GRCm39) D48G probably damaging Het
Mrps10 T C 17: 47,689,208 (GRCm39) *202Q probably null Het
Mrps14 T C 1: 160,024,559 (GRCm39) V30A probably benign Het
Mtmr7 G A 8: 41,059,927 (GRCm39) A62V possibly damaging Het
Muc2 G T 7: 141,281,631 (GRCm39) G497W probably damaging Het
Nnt A T 13: 119,523,181 (GRCm39) V237D probably damaging Het
Nox4 G T 7: 87,023,589 (GRCm39) V492L probably benign Het
Obscn C G 11: 59,003,381 (GRCm39) E1306Q probably benign Het
Or5ak23 T C 2: 85,244,563 (GRCm39) Y220C probably benign Het
Or6aa1 A G 7: 86,043,938 (GRCm39) I256T probably damaging Het
Pard3 A G 8: 128,137,231 (GRCm39) N861S probably benign Het
Pdlim4 G A 11: 53,946,048 (GRCm39) R230* probably null Het
Pinlyp C T 7: 24,241,550 (GRCm39) V159M possibly damaging Het
Pla2g4d T C 2: 120,119,645 (GRCm39) probably benign Het
Plcb1 A T 2: 135,201,613 (GRCm39) T855S probably benign Het
Prom1 T C 5: 44,187,111 (GRCm39) D382G probably benign Het
Prss16 A T 13: 22,192,834 (GRCm39) N83K probably damaging Het
Ptprn2 A G 12: 116,804,884 (GRCm39) D133G probably benign Het
Rasef C T 4: 73,659,166 (GRCm39) probably null Het
Rbak A G 5: 143,160,241 (GRCm39) S271P probably damaging Het
Rbm20 A T 19: 53,666,016 (GRCm39) I60F possibly damaging Het
Rftn1 G T 17: 50,354,408 (GRCm39) A318D probably damaging Het
Rsf1 G GACGGCCGCC 7: 97,229,116 (GRCm39) probably benign Het
Serpinb3c A G 1: 107,200,904 (GRCm39) L171P probably damaging Het
Slc25a19 T C 11: 115,506,376 (GRCm39) Y211C unknown Het
Sorbs2 C T 8: 46,248,507 (GRCm39) S586L probably damaging Het
Spesp1 A T 9: 62,180,733 (GRCm39) S58R probably benign Het
Spryd3 A G 15: 102,026,762 (GRCm39) I329T probably benign Het
St8sia2 G A 7: 73,616,700 (GRCm39) L113F probably damaging Het
Star T C 8: 26,299,883 (GRCm39) I75T possibly damaging Het
Tasor2 A T 13: 3,644,331 (GRCm39) F129Y possibly damaging Het
Tdrd6 T A 17: 43,938,697 (GRCm39) I784F possibly damaging Het
Tex55 G A 16: 38,632,826 (GRCm39) Q369* probably null Het
Tsc22d4 A G 5: 137,766,273 (GRCm39) I144V unknown Het
Tspan8 T C 10: 115,669,229 (GRCm39) probably null Het
Ttll9 C T 2: 152,804,407 (GRCm39) probably benign Het
Ttn T C 2: 76,640,194 (GRCm39) probably benign Het
Ubr4 T G 4: 139,194,587 (GRCm39) L1160R unknown Het
Ufd1 A G 16: 18,642,035 (GRCm39) Y162C possibly damaging Het
Unc13c A T 9: 73,641,690 (GRCm39) F1268I probably benign Het
Uvssa T C 5: 33,568,295 (GRCm39) I561T probably damaging Het
Vmn2r15 A T 5: 109,434,254 (GRCm39) S817T probably damaging Het
Ybx1 T C 4: 119,139,476 (GRCm39) E173G probably damaging Het
Zc3h6 T C 2: 128,857,400 (GRCm39) S640P possibly damaging Het
Other mutations in Pot1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Pot1a APN 6 25,744,627 (GRCm39) missense probably benign 0.01
IGL01393:Pot1a APN 6 25,744,630 (GRCm39) nonsense probably null
IGL01411:Pot1a APN 6 25,750,143 (GRCm39) splice site probably benign
IGL01774:Pot1a APN 6 25,753,276 (GRCm39) missense probably benign 0.00
IGL01981:Pot1a APN 6 25,750,099 (GRCm39) missense probably damaging 1.00
IGL02404:Pot1a APN 6 25,764,431 (GRCm39) splice site probably benign
IGL02530:Pot1a APN 6 25,794,592 (GRCm39) missense probably damaging 1.00
IGL02755:Pot1a APN 6 25,771,612 (GRCm39) missense possibly damaging 0.81
IGL03127:Pot1a APN 6 25,794,615 (GRCm39) missense probably benign 0.00
IGL03396:Pot1a APN 6 25,745,913 (GRCm39) missense possibly damaging 0.93
BB001:Pot1a UTSW 6 25,753,309 (GRCm39) missense possibly damaging 0.94
BB011:Pot1a UTSW 6 25,753,309 (GRCm39) missense possibly damaging 0.94
R0329:Pot1a UTSW 6 25,778,830 (GRCm39) splice site probably benign
R0359:Pot1a UTSW 6 25,771,679 (GRCm39) splice site probably benign
R0530:Pot1a UTSW 6 25,771,540 (GRCm39) missense possibly damaging 0.86
R0840:Pot1a UTSW 6 25,748,283 (GRCm39) splice site probably benign
R0918:Pot1a UTSW 6 25,756,267 (GRCm39) missense possibly damaging 0.92
R1650:Pot1a UTSW 6 25,745,964 (GRCm39) missense probably damaging 1.00
R1937:Pot1a UTSW 6 25,753,323 (GRCm39) missense probably benign 0.15
R2142:Pot1a UTSW 6 25,750,043 (GRCm39) splice site probably null
R4072:Pot1a UTSW 6 25,752,356 (GRCm39) splice site probably null
R4074:Pot1a UTSW 6 25,752,356 (GRCm39) splice site probably null
R4322:Pot1a UTSW 6 25,745,929 (GRCm39) missense probably benign 0.02
R4895:Pot1a UTSW 6 25,753,205 (GRCm39) missense probably damaging 1.00
R4910:Pot1a UTSW 6 25,746,020 (GRCm39) intron probably benign
R4933:Pot1a UTSW 6 25,771,540 (GRCm39) missense possibly damaging 0.86
R5530:Pot1a UTSW 6 25,778,893 (GRCm39) missense probably damaging 1.00
R5748:Pot1a UTSW 6 25,758,855 (GRCm39) missense possibly damaging 0.77
R5775:Pot1a UTSW 6 25,757,297 (GRCm39) splice site probably null
R5870:Pot1a UTSW 6 25,778,950 (GRCm39) missense possibly damaging 0.90
R6180:Pot1a UTSW 6 25,771,620 (GRCm39) missense probably benign 0.00
R6377:Pot1a UTSW 6 25,778,869 (GRCm39) missense probably benign 0.06
R7251:Pot1a UTSW 6 25,752,497 (GRCm39) splice site probably null
R7457:Pot1a UTSW 6 25,771,621 (GRCm39) missense probably benign 0.26
R7679:Pot1a UTSW 6 25,771,633 (GRCm39) missense probably benign 0.16
R7717:Pot1a UTSW 6 25,758,822 (GRCm39) missense probably benign 0.45
R8078:Pot1a UTSW 6 25,750,107 (GRCm39) missense probably benign 0.13
R8084:Pot1a UTSW 6 25,771,535 (GRCm39) missense possibly damaging 0.81
R8170:Pot1a UTSW 6 25,758,802 (GRCm39) makesense probably null
R9070:Pot1a UTSW 6 25,744,629 (GRCm39) missense
R9525:Pot1a UTSW 6 25,745,916 (GRCm39) missense probably benign 0.06
R9574:Pot1a UTSW 6 25,775,718 (GRCm39) missense possibly damaging 0.73
R9638:Pot1a UTSW 6 25,750,106 (GRCm39) nonsense probably null
R9698:Pot1a UTSW 6 25,744,615 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCAAATAACAAGTCTCTTACCTTCTA -3'
(R):5'- ATCTTGCCATATAATGTTGAACATCT -3'

Sequencing Primer
(F):5'- CTTCAGTGGTCCAGACTT -3'
(R):5'- ATATCATGTGTATGCCTGGCAC -3'
Posted On 2020-08-07