Mutagenetix > Incidental Mutation

Incidental Mutation 'R7924:Gucy2c'

643195

Institutional Source

Beutler Lab

Gene Symbol

Gucy2c

Ensembl Gene

ENSMUSG00000042638

Gene Name

guanylate cyclase 2c

Synonyms

GC-C

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7924 (G1)

Quality Score

999

Status

Validated

Chromosome

Chromosomal Location

136697284-136781765 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 136763055 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 258 (V258E)

Ref Sequence

ENSEMBL: ENSMUSP00000032338 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032338] [ENSMUST00000078095]

AlphaFold

Q3UWA6

Predicted Effect

probably benign
Transcript: ENSMUST00000032338
AA Change: V258E

PolyPhen 2 Score 0.354 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000032338
Gene: ENSMUSG00000042638
AA Change: V258E

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	113	384	3.7e-8	PFAM
transmembrane domain	432	454	N/A	INTRINSIC
Pfam:Pkinase_Tyr	498	744	3.4e-33	PFAM
Pfam:Pkinase	499	744	1e-26	PFAM
CYCc	787	982	2.68e-107	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000078095
AA Change: V258E

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000077236
Gene: ENSMUSG00000042638
AA Change: V258E

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	53	385	2.7e-41	PFAM
transmembrane domain	432	454	N/A	INTRINSIC
Pfam:Pkinase_Tyr	475	720	6.5e-32	PFAM
Pfam:Pkinase	480	720	7.2e-25	PFAM
CYCc	763	958	2.68e-107	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.7%

Validation Efficiency

99% (78/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that functions as a receptor for endogenous peptides guanylin and uroguanylin, and the heat-stable E. coli enterotoxin. The encoded protein activates the cystic fibrosis transmembrane conductance regulator. Mutations in this gene are associated with familial diarrhea (autosomal dominant) and meconium ileus (autosomal recessive). [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous null mice are viable and have an increased resistance to heat-stable enterotoxins. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022B05Rik	T	A	8: 124,663,312		probably benign	Het
4930435E12Rik	G	A	16: 38,812,464	Q369*	probably null	Het
Acacb	A	G	5: 114,245,220	K2155E	possibly damaging	Het
Adgre5	G	A	8: 83,729,400	P256S	possibly damaging	Het
Adipor1	T	A	1: 134,425,993	V172D	probably damaging	Het
Ahsa1	T	C	12: 87,270,456		probably null	Het
Ankrd11	T	C	8: 122,895,902	I404V	possibly damaging	Het
Asxl3	G	A	18: 22,525,545	R2204Q	probably damaging	Het
Barhl2	A	G	5: 106,457,649	S65P	unknown	Het
Bbx	A	T	16: 50,224,308	L630H	probably damaging	Het
Cars	T	C	7: 143,569,871	T531A	possibly damaging	Het
Catsperb	T	A	12: 101,520,565	H450Q	probably benign	Het
Cdt1	T	C	8: 122,569,352	L135P	probably damaging	Het
Cemip	A	T	7: 83,943,715		probably benign	Het
Cfap206	T	A	4: 34,728,833	H24L	probably benign	Het
Cnga4	T	A	7: 105,407,821	V480E	probably benign	Het
Cnot1	ACG	A	8: 95,745,647		probably null	Het
Ctcfl	G	A	2: 173,113,656	T271I	possibly damaging	Het
Dlc1	T	C	8: 36,571,416	R1003G	probably benign	Het
Dnah7b	A	G	1: 46,219,430	D1927G	probably benign	Het
Dscc1	A	T	15: 55,082,176	D374E	probably benign	Het
Eci2	G	A	13: 34,993,070	Q69*	probably null	Het
Ep300	C	A	15: 81,649,502	P1920Q	unknown	Het
Epha5	A	G	5: 84,084,846	Y629H	possibly damaging	Het
Fam208b	A	T	13: 3,594,331	F129Y	possibly damaging	Het
Fat2	G	A	11: 55,262,787	T3533I	probably benign	Het
Fat3	T	C	9: 15,999,297	N1803S	probably damaging	Het
Fcrls	T	C	3: 87,259,533	Y51C	probably damaging	Het
G530012D18Rik	C	G	1: 85,577,214	D113E	unknown	Het
Gcnt2	A	T	13: 40,918,564	K228*	probably null	Het
Hecw1	C	A	13: 14,322,528	L298F	probably damaging	Het
Hydin	T	G	8: 110,418,471	V818G	possibly damaging	Het
Hykk	A	G	9: 54,922,240	Y131C	probably damaging	Het
Ick	T	C	9: 78,155,464	L260P	probably damaging	Het
Mpo	A	G	11: 87,794,840	D48G	probably damaging	Het
Mrps10	T	C	17: 47,378,283	*202Q	probably null	Het
Mrps14	T	C	1: 160,196,989	V30A	probably benign	Het
Mtmr7	G	A	8: 40,606,884	A62V	possibly damaging	Het
Muc2	G	T	7: 141,695,388	G497W	probably damaging	Het
Nnt	A	T	13: 119,386,645	V237D	probably damaging	Het
Nox4	G	T	7: 87,374,381	V492L	probably benign	Het
Obscn	C	G	11: 59,112,555	E1306Q	probably benign	Het
Olfr303	A	G	7: 86,394,730	I256T	probably damaging	Het
Olfr993	T	C	2: 85,414,219	Y220C	probably benign	Het
Pard3	A	G	8: 127,410,750	N861S	probably benign	Het
Pdlim4	G	A	11: 54,055,222	R230*	probably null	Het
Pinlyp	C	T	7: 24,542,125	V159M	possibly damaging	Het
Pla2g4d	T	C	2: 120,289,164		probably benign	Het
Plcb1	A	T	2: 135,359,693	T855S	probably benign	Het
Pot1a	T	A	6: 25,753,310	D409V	possibly damaging	Het
Prom1	T	C	5: 44,029,769	D382G	probably benign	Het
Prss16	A	T	13: 22,008,664	N83K	probably damaging	Het
Ptprn2	A	G	12: 116,841,264	D133G	probably benign	Het
Rasef	C	T	4: 73,740,929		probably null	Het
Rbak	A	G	5: 143,174,486	S271P	probably damaging	Het
Rbm20	A	T	19: 53,677,585	I60F	possibly damaging	Het
Rftn1	G	T	17: 50,047,380	A318D	probably damaging	Het
Rsf1	G	GACGGCCGCC	7: 97,579,909		probably benign	Het
Serpinb3c	A	G	1: 107,273,174	L171P	probably damaging	Het
Slc25a19	T	C	11: 115,615,550	Y211C	unknown	Het
Sorbs2	C	T	8: 45,795,470	S586L	probably damaging	Het
Spesp1	A	T	9: 62,273,451	S58R	probably benign	Het
Spryd3	A	G	15: 102,118,327	I329T	probably benign	Het
St8sia2	G	A	7: 73,966,952	L113F	probably damaging	Het
Star	T	C	8: 25,809,855	I75T	possibly damaging	Het
Tdrd6	T	A	17: 43,627,806	I784F	possibly damaging	Het
Tsc22d4	A	G	5: 137,768,011	I144V	unknown	Het
Tspan8	T	C	10: 115,833,324		probably null	Het
Ttll9	C	T	2: 152,962,487		probably benign	Het
Ttn	T	C	2: 76,809,850		probably benign	Het
Ubr4	T	G	4: 139,467,276	L1160R	unknown	Het
Ufd1	A	G	16: 18,823,285	Y162C	possibly damaging	Het
Unc13c	A	T	9: 73,734,408	F1268I	probably benign	Het
Uvssa	T	C	5: 33,410,951	I561T	probably damaging	Het
Vmn2r15	A	T	5: 109,286,388	S817T	probably damaging	Het
Ybx1	T	C	4: 119,282,279	E173G	probably damaging	Het
Zc3h6	T	C	2: 129,015,480	S640P	possibly damaging	Het

Other mutations in Gucy2c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00849:Gucy2c	APN	6	136765614	missense	probably benign	0.01
IGL01081:Gucy2c	APN	6	136702739	missense	probably damaging	1.00
IGL01285:Gucy2c	APN	6	136709741	missense	probably damaging	1.00
IGL01395:Gucy2c	APN	6	136698029	missense	probably damaging	1.00
IGL01408:Gucy2c	APN	6	136698011	missense	probably benign	0.19
IGL01752:Gucy2c	APN	6	136770108	missense	probably benign	0.10
IGL01766:Gucy2c	APN	6	136715973	missense	probably benign	0.43
IGL02245:Gucy2c	APN	6	136729203	missense	probably benign	0.00
IGL02648:Gucy2c	APN	6	136729213	nonsense	probably null
IGL02794:Gucy2c	APN	6	136713148	missense	probably damaging	1.00
IGL03023:Gucy2c	APN	6	136702796	splice site	probably null
IGL03178:Gucy2c	APN	6	136729239	splice site	probably benign
IGL03310:Gucy2c	APN	6	136751046	missense	probably benign
IGL03374:Gucy2c	APN	6	136765630	missense	probably benign	0.00
IGL03393:Gucy2c	APN	6	136719667	missense	probably benign	0.04
BB001:Gucy2c	UTSW	6	136763055	missense	probably benign	0.35
BB011:Gucy2c	UTSW	6	136763055	missense	probably benign	0.35
R0031:Gucy2c	UTSW	6	136697999	missense	probably damaging	0.99
R0128:Gucy2c	UTSW	6	136704249	missense	probably damaging	1.00
R0377:Gucy2c	UTSW	6	136750917	critical splice donor site	probably null
R0593:Gucy2c	UTSW	6	136728335	missense	probably damaging	0.99
R0613:Gucy2c	UTSW	6	136760723	missense	probably damaging	1.00
R0723:Gucy2c	UTSW	6	136727801	splice site	probably null
R0828:Gucy2c	UTSW	6	136709748	missense	probably damaging	1.00
R0837:Gucy2c	UTSW	6	136722420	missense	probably damaging	0.99
R0880:Gucy2c	UTSW	6	136709832	critical splice acceptor site	probably null
R1350:Gucy2c	UTSW	6	136743914	critical splice donor site	probably null
R1487:Gucy2c	UTSW	6	136748826	missense	possibly damaging	0.79
R1680:Gucy2c	UTSW	6	136722493	missense	probably damaging	1.00
R1751:Gucy2c	UTSW	6	136748775	splice site	probably benign
R1791:Gucy2c	UTSW	6	136744027	missense	probably damaging	1.00
R1953:Gucy2c	UTSW	6	136704293	missense	probably damaging	1.00
R2135:Gucy2c	UTSW	6	136723728	missense	probably damaging	1.00
R2227:Gucy2c	UTSW	6	136702760	missense	probably damaging	1.00
R2350:Gucy2c	UTSW	6	136763074	missense	probably damaging	0.98
R2906:Gucy2c	UTSW	6	136708387	missense	probably damaging	1.00
R2907:Gucy2c	UTSW	6	136708387	missense	probably damaging	1.00
R3699:Gucy2c	UTSW	6	136770111	missense	probably damaging	1.00
R3972:Gucy2c	UTSW	6	136708366	missense	probably damaging	1.00
R4613:Gucy2c	UTSW	6	136708321	missense	probably damaging	1.00
R4732:Gucy2c	UTSW	6	136767152	missense	probably damaging	1.00
R4733:Gucy2c	UTSW	6	136767152	missense	probably damaging	1.00
R4776:Gucy2c	UTSW	6	136722514	missense	probably damaging	1.00
R5087:Gucy2c	UTSW	6	136767035	missense	possibly damaging	0.69
R5284:Gucy2c	UTSW	6	136763043	missense	possibly damaging	0.56
R5366:Gucy2c	UTSW	6	136720741	missense	probably damaging	0.99
R5466:Gucy2c	UTSW	6	136781465	nonsense	probably null
R5911:Gucy2c	UTSW	6	136722442	missense	probably damaging	1.00
R6160:Gucy2c	UTSW	6	136740686	nonsense	probably null
R6367:Gucy2c	UTSW	6	136709778	missense	probably damaging	1.00
R6441:Gucy2c	UTSW	6	136723761	missense	probably damaging	0.98
R6812:Gucy2c	UTSW	6	136697995	missense	probably benign
R6865:Gucy2c	UTSW	6	136770129	missense	probably benign	0.13
R7065:Gucy2c	UTSW	6	136720766	missense	probably damaging	1.00
R7078:Gucy2c	UTSW	6	136697939	missense	probably benign	0.19
R7096:Gucy2c	UTSW	6	136728341	missense	probably benign	0.11
R7138:Gucy2c	UTSW	6	136728344	missense	probably damaging	1.00
R7343:Gucy2c	UTSW	6	136702748	missense	probably damaging	1.00
R7538:Gucy2c	UTSW	6	136709744	missense	probably damaging	1.00
R7587:Gucy2c	UTSW	6	136704290	missense	probably damaging	1.00
R7666:Gucy2c	UTSW	6	136697968	missense	probably benign
R7675:Gucy2c	UTSW	6	136716032	missense	possibly damaging	0.91
R7822:Gucy2c	UTSW	6	136708406	missense	probably damaging	1.00
R7842:Gucy2c	UTSW	6	136769816	splice site	probably null
R8078:Gucy2c	UTSW	6	136697921	missense	probably damaging	1.00
R8094:Gucy2c	UTSW	6	136737448	missense	probably benign	0.33
R8391:Gucy2c	UTSW	6	136704215	missense	probably damaging	1.00
R8428:Gucy2c	UTSW	6	136727894	missense	probably damaging	0.96
R9188:Gucy2c	UTSW	6	136723758	missense	probably benign	0.44
R9189:Gucy2c	UTSW	6	136751047	missense	probably benign
R9325:Gucy2c	UTSW	6	136766994	nonsense	probably null
R9361:Gucy2c	UTSW	6	136737431	missense	possibly damaging	0.80
R9413:Gucy2c	UTSW	6	136723773	missense	possibly damaging	0.94
Z1088:Gucy2c	UTSW	6	136743981	missense	probably benign
Z1177:Gucy2c	UTSW	6	136719687	missense	probably damaging	1.00
Z1177:Gucy2c	UTSW	6	136767196	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTCAAATGCGGCCATCATGG -3'
(R):5'- AGCTTTGGGGACTTGAGATTAATC -3'

Sequencing Primer
(F):5'- GCGGCTGCCCACACAAG -3'
(R):5'- GCCATCCTGGACTATGTAGTAAC -3'

Posted On

2020-08-07