Mutagenetix > Incidental Mutation

Incidental Mutation 'R7924:Muc2'

643202

Institutional Source

Beutler Lab

Gene Symbol

Muc2

Ensembl Gene

ENSMUSG00000025515

Gene Name

mucin 2

Synonyms

2010015E03Rik

MMRRC Submission

Accession Numbers

Genbank: BC034197; MGI: 1339364

Essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R7924 (G1)

Quality Score

999

Status

Validated

Chromosome

Chromosomal Location

141690340-141754693 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 141695388 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Tryptophan at position 497 (G497W)

Ref Sequence

ENSEMBL: ENSMUSP00000141040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167366] [ENSMUST00000179227] [ENSMUST00000185406] [ENSMUST00000185823]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000167366

SMART Domains

Protein: ENSMUSP00000128250
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
Pfam:VWD	3	72	2.3e-14	PFAM
C8	107	181	1.82e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000179227

SMART Domains

Protein: ENSMUSP00000136692
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
C8	11	85	1.61e-32	SMART
Blast:VWD	102	128	5e-8	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000185406
AA Change: G497W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141040
Gene: ENSMUSG00000025515
AA Change: G497W

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
VWD	20	183	1.5e-40	SMART
C8	216	290	3.9e-15	SMART
Pfam:TIL	293	349	5.4e-10	PFAM
VWC	351	411	7e-4	SMART
VWD	378	542	8.8e-44	SMART
C8	579	653	1.2e-36	SMART
SCOP:d1coua_	654	728	4e-8	SMART
VWC_def	820	865	1.3e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000185823

SMART Domains

Protein: ENSMUSP00000140855
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
Pfam:VWD	3	73	5.6e-14	PFAM
C8	108	182	1.4e-35	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.7%

Validation Efficiency

99% (78/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022B05Rik	T	A	8: 124,663,312		probably benign	Het
4930435E12Rik	G	A	16: 38,812,464	Q369*	probably null	Het
Acacb	A	G	5: 114,245,220	K2155E	possibly damaging	Het
Adgre5	G	A	8: 83,729,400	P256S	possibly damaging	Het
Adipor1	T	A	1: 134,425,993	V172D	probably damaging	Het
Ahsa1	T	C	12: 87,270,456		probably null	Het
Ankrd11	T	C	8: 122,895,902	I404V	possibly damaging	Het
Asxl3	G	A	18: 22,525,545	R2204Q	probably damaging	Het
Barhl2	A	G	5: 106,457,649	S65P	unknown	Het
Bbx	A	T	16: 50,224,308	L630H	probably damaging	Het
Cars	T	C	7: 143,569,871	T531A	possibly damaging	Het
Catsperb	T	A	12: 101,520,565	H450Q	probably benign	Het
Cdt1	T	C	8: 122,569,352	L135P	probably damaging	Het
Cemip	A	T	7: 83,943,715		probably benign	Het
Cfap206	T	A	4: 34,728,833	H24L	probably benign	Het
Cnga4	T	A	7: 105,407,821	V480E	probably benign	Het
Cnot1	ACG	A	8: 95,745,647		probably null	Het
Ctcfl	G	A	2: 173,113,656	T271I	possibly damaging	Het
Dlc1	T	C	8: 36,571,416	R1003G	probably benign	Het
Dnah7b	A	G	1: 46,219,430	D1927G	probably benign	Het
Dscc1	A	T	15: 55,082,176	D374E	probably benign	Het
Eci2	G	A	13: 34,993,070	Q69*	probably null	Het
Ep300	C	A	15: 81,649,502	P1920Q	unknown	Het
Epha5	A	G	5: 84,084,846	Y629H	possibly damaging	Het
Fam208b	A	T	13: 3,594,331	F129Y	possibly damaging	Het
Fat2	G	A	11: 55,262,787	T3533I	probably benign	Het
Fat3	T	C	9: 15,999,297	N1803S	probably damaging	Het
Fcrls	T	C	3: 87,259,533	Y51C	probably damaging	Het
G530012D18Rik	C	G	1: 85,577,214	D113E	unknown	Het
Gcnt2	A	T	13: 40,918,564	K228*	probably null	Het
Gucy2c	A	T	6: 136,763,055	V258E	probably benign	Het
Hecw1	C	A	13: 14,322,528	L298F	probably damaging	Het
Hydin	T	G	8: 110,418,471	V818G	possibly damaging	Het
Hykk	A	G	9: 54,922,240	Y131C	probably damaging	Het
Ick	T	C	9: 78,155,464	L260P	probably damaging	Het
Mpo	A	G	11: 87,794,840	D48G	probably damaging	Het
Mrps10	T	C	17: 47,378,283	*202Q	probably null	Het
Mrps14	T	C	1: 160,196,989	V30A	probably benign	Het
Mtmr7	G	A	8: 40,606,884	A62V	possibly damaging	Het
Nnt	A	T	13: 119,386,645	V237D	probably damaging	Het
Nox4	G	T	7: 87,374,381	V492L	probably benign	Het
Obscn	C	G	11: 59,112,555	E1306Q	probably benign	Het
Olfr303	A	G	7: 86,394,730	I256T	probably damaging	Het
Olfr993	T	C	2: 85,414,219	Y220C	probably benign	Het
Pard3	A	G	8: 127,410,750	N861S	probably benign	Het
Pdlim4	G	A	11: 54,055,222	R230*	probably null	Het
Pinlyp	C	T	7: 24,542,125	V159M	possibly damaging	Het
Pla2g4d	T	C	2: 120,289,164		probably benign	Het
Plcb1	A	T	2: 135,359,693	T855S	probably benign	Het
Pot1a	T	A	6: 25,753,310	D409V	possibly damaging	Het
Prom1	T	C	5: 44,029,769	D382G	probably benign	Het
Prss16	A	T	13: 22,008,664	N83K	probably damaging	Het
Ptprn2	A	G	12: 116,841,264	D133G	probably benign	Het
Rasef	C	T	4: 73,740,929		probably null	Het
Rbak	A	G	5: 143,174,486	S271P	probably damaging	Het
Rbm20	A	T	19: 53,677,585	I60F	possibly damaging	Het
Rftn1	G	T	17: 50,047,380	A318D	probably damaging	Het
Rsf1	G	GACGGCCGCC	7: 97,579,909		probably benign	Het
Serpinb3c	A	G	1: 107,273,174	L171P	probably damaging	Het
Slc25a19	T	C	11: 115,615,550	Y211C	unknown	Het
Sorbs2	C	T	8: 45,795,470	S586L	probably damaging	Het
Spesp1	A	T	9: 62,273,451	S58R	probably benign	Het
Spryd3	A	G	15: 102,118,327	I329T	probably benign	Het
St8sia2	G	A	7: 73,966,952	L113F	probably damaging	Het
Star	T	C	8: 25,809,855	I75T	possibly damaging	Het
Tdrd6	T	A	17: 43,627,806	I784F	possibly damaging	Het
Tsc22d4	A	G	5: 137,768,011	I144V	unknown	Het
Tspan8	T	C	10: 115,833,324		probably null	Het
Ttll9	C	T	2: 152,962,487		probably benign	Het
Ttn	T	C	2: 76,809,850		probably benign	Het
Ubr4	T	G	4: 139,467,276	L1160R	unknown	Het
Ufd1	A	G	16: 18,823,285	Y162C	possibly damaging	Het
Unc13c	A	T	9: 73,734,408	F1268I	probably benign	Het
Uvssa	T	C	5: 33,410,951	I561T	probably damaging	Het
Vmn2r15	A	T	5: 109,286,388	S817T	probably damaging	Het
Ybx1	T	C	4: 119,282,279	E173G	probably damaging	Het
Zc3h6	T	C	2: 129,015,480	S640P	possibly damaging	Het

Other mutations in Muc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Eeyore	APN	7	141693356	missense	probably benign	0.35
kenny	APN	7		nonsense
Winnie	APN	7	141699460	missense	probably damaging	1.00
IGL01303:Muc2	APN	7	141752395	missense	probably benign
IGL01482:Muc2	APN	7	141754060	missense	probably damaging	0.96
IGL01875:Muc2	APN	7	141752740	missense	probably damaging	0.99
IGL02088:Muc2	APN	7	141751504	missense	probably damaging	1.00
IGL02415:Muc2	APN	7	141751872	nonsense	probably null
IGL02548:Muc2	APN	7	141751857	missense	probably damaging	1.00
IGL02836:Muc2	APN	7	141746713	unclassified	probably benign
IGL03196:Muc2	APN	7	141747630	missense	probably damaging	0.97
Muskatenwein	UTSW	7	141753439	missense	unknown
nomoco	UTSW	7	141753719	missense	probably damaging	1.00
Schlendrian	UTSW	7	141695682	missense	probably damaging	1.00
Seco	UTSW	7	141698733	missense	probably damaging	1.00
BB001:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
BB011:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
E0370:Muc2	UTSW	7	141696355	missense	probably damaging	1.00
R0127:Muc2	UTSW	7	141748954	missense	probably benign	0.00
R0179:Muc2	UTSW	7	141748971	missense	probably damaging	1.00
R0201:Muc2	UTSW	7	141699185	frame shift	probably null
R0299:Muc2	UTSW	7	141752729	missense	probably damaging	1.00
R0547:Muc2	UTSW	7	141699185	frame shift	probably null
R0699:Muc2	UTSW	7	141752300	missense	probably damaging	1.00
R0900:Muc2	UTSW	7	141699185	frame shift	probably null
R1348:Muc2	UTSW	7	141699185	frame shift	probably null
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1625:Muc2	UTSW	7	141697162	missense	probably damaging	1.00
R2010:Muc2	UTSW	7	141700875	missense	probably damaging	0.99
R2149:Muc2	UTSW	7	141699185	frame shift	probably null
R2163:Muc2	UTSW	7	141699185	frame shift	probably null
R3008:Muc2	UTSW	7	141695104	missense	possibly damaging	0.93
R3110:Muc2	UTSW	7	141745488	unclassified	probably benign
R3112:Muc2	UTSW	7	141745488	unclassified	probably benign
R3424:Muc2	UTSW	7	141693352	missense	probably damaging	0.99
R3786:Muc2	UTSW	7	141697347	missense	probably benign	0.01
R3854:Muc2	UTSW	7	141754344	missense	probably damaging	1.00
R3964:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3965:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3966:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3973:Muc2	UTSW	7	141746804	unclassified	probably benign
R3974:Muc2	UTSW	7	141746804	unclassified	probably benign
R3976:Muc2	UTSW	7	141746804	unclassified	probably benign
R4327:Muc2	UTSW	7	141695334	missense	probably damaging	0.96
R4694:Muc2	UTSW	7	141752345	missense	probably damaging	1.00
R4764:Muc2	UTSW	7	141745608	missense	possibly damaging	0.88
R4769:Muc2	UTSW	7	141699691	critical splice donor site	probably null
R4798:Muc2	UTSW	7	141754140	missense	probably benign	0.01
R4900:Muc2	UTSW	7	141749543	missense	probably benign	0.32
R5383:Muc2	UTSW	7	141753719	missense	probably damaging	1.00
R5489:Muc2	UTSW	7	141751432	missense	probably benign	0.00
R5615:Muc2	UTSW	7	141691203	missense	probably damaging	1.00
R5856:Muc2	UTSW	7	141745644	unclassified	probably benign
R5919:Muc2	UTSW	7	141694928	missense	probably damaging	0.97
R5953:Muc2	UTSW	7	141701382	missense	probably damaging	0.96
R5979:Muc2	UTSW	7	141697250	splice site	probably null
R5979:Muc2	UTSW	7	141751406	missense	probably damaging	0.99
R6175:Muc2	UTSW	7	141696632	missense	probably damaging	1.00
R6213:Muc2	UTSW	7	141751414	missense	probably damaging	1.00
R6281:Muc2	UTSW	7	141752403	missense	probably damaging	1.00
R6321:Muc2	UTSW	7	141700828	missense	probably benign	0.28
R6390:Muc2	UTSW	7	141752146	missense	probably damaging	0.97
R6485:Muc2	UTSW	7	141746736	unclassified	probably benign
R6582:Muc2	UTSW	7	141696698	missense	probably benign	0.00
R6683:Muc2	UTSW	7	141751477	missense	probably benign	0.38
R6896:Muc2	UTSW	7	141752695	missense	possibly damaging	0.48
R6906:Muc2	UTSW	7	141698733	missense	probably damaging	1.00
R6924:Muc2	UTSW	7	141697834	missense	possibly damaging	0.87
R7040:Muc2	UTSW	7	141751457	missense	unknown
R7222:Muc2	UTSW	7	141704209	missense
R7251:Muc2	UTSW	7	141692722	missense	possibly damaging	0.91
R7282:Muc2	UTSW	7	141752744	missense
R7315:Muc2	UTSW	7	141690402	missense	probably damaging	0.99
R7421:Muc2	UTSW	7	141748126	missense
R7556:Muc2	UTSW	7	141753702	missense
R7651:Muc2	UTSW	7	141704201	missense
R7710:Muc2	UTSW	7	141700883	missense	possibly damaging	0.92
R7776:Muc2	UTSW	7	141704393	missense
R7813:Muc2	UTSW	7	141696300	splice site	probably null
R7843:Muc2	UTSW	7	141695419	missense	probably benign	0.03
R7869:Muc2	UTSW	7	141749734	missense
R7993:Muc2	UTSW	7	141754436	missense
R8053:Muc2	UTSW	7	141698332	missense	probably benign	0.01
R8068:Muc2	UTSW	7	141744685	missense
R8099:Muc2	UTSW	7	141745438	splice site	probably null
R8192:Muc2	UTSW	7	141751478	missense
R8194:Muc2	UTSW	7	141704252	missense
R8545:Muc2	UTSW	7	141752393	missense	unknown
R8701:Muc2	UTSW	7	141695607	missense	probably damaging	1.00
R8883:Muc2	UTSW	7	141700900	missense	probably damaging	0.98
R8894:Muc2	UTSW	7	141694515	missense	probably damaging	1.00
R8905:Muc2	UTSW	7	141693400	missense	probably benign	0.00
R9024:Muc2	UTSW	7	141701367	missense	probably damaging	0.98
R9032:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9085:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9091:Muc2	UTSW	7	141704267	missense
R9104:Muc2	UTSW	7	141699655	missense	probably damaging	1.00
R9114:Muc2	UTSW	7	141701414	nonsense	probably null
R9270:Muc2	UTSW	7	141704267	missense
R9297:Muc2	UTSW	7	141749022	missense
R9325:Muc2	UTSW	7	141744822	missense
R9354:Muc2	UTSW	7	141753420	missense
R9386:Muc2	UTSW	7	141693146	missense	probably damaging	1.00
R9529:Muc2	UTSW	7	141700884	missense	possibly damaging	0.55
R9550:Muc2	UTSW	7	141754505	missense	probably damaging	1.00
R9583:Muc2	UTSW	7	141746822	missense
R9607:Muc2	UTSW	7	141751453	missense
R9646:Muc2	UTSW	7	141690400	missense	probably benign
R9651:Muc2	UTSW	7	141701445	missense	probably damaging	0.99
R9774:Muc2	UTSW	7	141699242	missense	probably benign
R9784:Muc2	UTSW	7	141694542	nonsense	probably null
Z1176:Muc2	UTSW	7	141746714	missense
Z1177:Muc2	UTSW	7	141744794	missense

Predicted Primers

PCR Primer
(F):5'- TTGTGTCCTCAGGCAGACTC -3'
(R):5'- CATCACTCTCTAGGCCATTGAAG -3'

Sequencing Primer
(F):5'- CTCAGGCAGACTCTATTCTTGGG -3'
(R):5'- GGCCATTGAAGTTTCCACAG -3'

Posted On

2020-08-07