Mutagenetix > Incidental Mutation

Incidental Mutation 'R7924:Star'

643204

Institutional Source

Beutler Lab

Gene Symbol

Star

Ensembl Gene

ENSMUSG00000031574

Gene Name

steroidogenic acute regulatory protein

Synonyms

D8Ertd419e

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7924 (G1)

Quality Score

999

Status

Validated

Chromosome

Chromosomal Location

25806555-25815982 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 25809855 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 75 (I75T)

Ref Sequence

ENSEMBL: ENSMUSP00000033979 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033979] [ENSMUST00000210565]

AlphaFold

P51557

Predicted Effect

possibly damaging
Transcript: ENSMUST00000033979
AA Change: I75T

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000033979
Gene: ENSMUSG00000031574
AA Change: I75T

Domain	Start	End	E-Value	Type
START	75	280	3.63e-72	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000210565
AA Change: I75T

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.7%

Validation Efficiency

99% (78/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a key role in the acute regulation of steroid hormone synthesis by enhancing the conversion of cholesterol into pregnenolone. This protein permits the cleavage of cholesterol into pregnenolone by mediating the transport of cholesterol from the outer mitochondrial membrane to the inner mitochondrial membrane. Mutations in this gene are a cause of congenital lipoid adrenal hyperplasia (CLAH), also called lipoid CAH. A pseudogene of this gene is located on chromosome 13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice fail to thrive and die during the postnatal period due to adrenocortical insufficiency. Mice exhibit male pseudohermaprhoditism and show a progressive accumulation of lipids within steroidogenic cells of the adrenal glands and gonads. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022B05Rik	T	A	8: 124,663,312		probably benign	Het
4930435E12Rik	G	A	16: 38,812,464	Q369*	probably null	Het
Acacb	A	G	5: 114,245,220	K2155E	possibly damaging	Het
Adgre5	G	A	8: 83,729,400	P256S	possibly damaging	Het
Adipor1	T	A	1: 134,425,993	V172D	probably damaging	Het
Ahsa1	T	C	12: 87,270,456		probably null	Het
Ankrd11	T	C	8: 122,895,902	I404V	possibly damaging	Het
Asxl3	G	A	18: 22,525,545	R2204Q	probably damaging	Het
Barhl2	A	G	5: 106,457,649	S65P	unknown	Het
Bbx	A	T	16: 50,224,308	L630H	probably damaging	Het
Cars	T	C	7: 143,569,871	T531A	possibly damaging	Het
Catsperb	T	A	12: 101,520,565	H450Q	probably benign	Het
Cdt1	T	C	8: 122,569,352	L135P	probably damaging	Het
Cemip	A	T	7: 83,943,715		probably benign	Het
Cfap206	T	A	4: 34,728,833	H24L	probably benign	Het
Cnga4	T	A	7: 105,407,821	V480E	probably benign	Het
Cnot1	ACG	A	8: 95,745,647		probably null	Het
Ctcfl	G	A	2: 173,113,656	T271I	possibly damaging	Het
Dlc1	T	C	8: 36,571,416	R1003G	probably benign	Het
Dnah7b	A	G	1: 46,219,430	D1927G	probably benign	Het
Dscc1	A	T	15: 55,082,176	D374E	probably benign	Het
Eci2	G	A	13: 34,993,070	Q69*	probably null	Het
Ep300	C	A	15: 81,649,502	P1920Q	unknown	Het
Epha5	A	G	5: 84,084,846	Y629H	possibly damaging	Het
Fam208b	A	T	13: 3,594,331	F129Y	possibly damaging	Het
Fat2	G	A	11: 55,262,787	T3533I	probably benign	Het
Fat3	T	C	9: 15,999,297	N1803S	probably damaging	Het
Fcrls	T	C	3: 87,259,533	Y51C	probably damaging	Het
G530012D18Rik	C	G	1: 85,577,214	D113E	unknown	Het
Gcnt2	A	T	13: 40,918,564	K228*	probably null	Het
Gucy2c	A	T	6: 136,763,055	V258E	probably benign	Het
Hecw1	C	A	13: 14,322,528	L298F	probably damaging	Het
Hydin	T	G	8: 110,418,471	V818G	possibly damaging	Het
Hykk	A	G	9: 54,922,240	Y131C	probably damaging	Het
Ick	T	C	9: 78,155,464	L260P	probably damaging	Het
Mpo	A	G	11: 87,794,840	D48G	probably damaging	Het
Mrps10	T	C	17: 47,378,283	*202Q	probably null	Het
Mrps14	T	C	1: 160,196,989	V30A	probably benign	Het
Mtmr7	G	A	8: 40,606,884	A62V	possibly damaging	Het
Muc2	G	T	7: 141,695,388	G497W	probably damaging	Het
Nnt	A	T	13: 119,386,645	V237D	probably damaging	Het
Nox4	G	T	7: 87,374,381	V492L	probably benign	Het
Obscn	C	G	11: 59,112,555	E1306Q	probably benign	Het
Olfr303	A	G	7: 86,394,730	I256T	probably damaging	Het
Olfr993	T	C	2: 85,414,219	Y220C	probably benign	Het
Pard3	A	G	8: 127,410,750	N861S	probably benign	Het
Pdlim4	G	A	11: 54,055,222	R230*	probably null	Het
Pinlyp	C	T	7: 24,542,125	V159M	possibly damaging	Het
Pla2g4d	T	C	2: 120,289,164		probably benign	Het
Plcb1	A	T	2: 135,359,693	T855S	probably benign	Het
Pot1a	T	A	6: 25,753,310	D409V	possibly damaging	Het
Prom1	T	C	5: 44,029,769	D382G	probably benign	Het
Prss16	A	T	13: 22,008,664	N83K	probably damaging	Het
Ptprn2	A	G	12: 116,841,264	D133G	probably benign	Het
Rasef	C	T	4: 73,740,929		probably null	Het
Rbak	A	G	5: 143,174,486	S271P	probably damaging	Het
Rbm20	A	T	19: 53,677,585	I60F	possibly damaging	Het
Rftn1	G	T	17: 50,047,380	A318D	probably damaging	Het
Rsf1	G	GACGGCCGCC	7: 97,579,909		probably benign	Het
Serpinb3c	A	G	1: 107,273,174	L171P	probably damaging	Het
Slc25a19	T	C	11: 115,615,550	Y211C	unknown	Het
Sorbs2	C	T	8: 45,795,470	S586L	probably damaging	Het
Spesp1	A	T	9: 62,273,451	S58R	probably benign	Het
Spryd3	A	G	15: 102,118,327	I329T	probably benign	Het
St8sia2	G	A	7: 73,966,952	L113F	probably damaging	Het
Tdrd6	T	A	17: 43,627,806	I784F	possibly damaging	Het
Tsc22d4	A	G	5: 137,768,011	I144V	unknown	Het
Tspan8	T	C	10: 115,833,324		probably null	Het
Ttll9	C	T	2: 152,962,487		probably benign	Het
Ttn	T	C	2: 76,809,850		probably benign	Het
Ubr4	T	G	4: 139,467,276	L1160R	unknown	Het
Ufd1	A	G	16: 18,823,285	Y162C	possibly damaging	Het
Unc13c	A	T	9: 73,734,408	F1268I	probably benign	Het
Uvssa	T	C	5: 33,410,951	I561T	probably damaging	Het
Vmn2r15	A	T	5: 109,286,388	S817T	probably damaging	Het
Ybx1	T	C	4: 119,282,279	E173G	probably damaging	Het
Zc3h6	T	C	2: 129,015,480	S640P	possibly damaging	Het

Other mutations in Star

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00970:Star	APN	8	25812866	splice site	probably null
IGL01337:Star	APN	8	25809864	missense	probably damaging	1.00
IGL02165:Star	APN	8	25812815	missense	possibly damaging	0.75
IGL03274:Star	APN	8	25811054	missense	possibly damaging	0.72
BB001:Star	UTSW	8	25809855	missense	possibly damaging	0.72
BB011:Star	UTSW	8	25809855	missense	possibly damaging	0.72
R1327:Star	UTSW	8	25809837	missense	probably benign	0.45
R3816:Star	UTSW	8	25809877	missense	probably benign	0.15
R4790:Star	UTSW	8	25808616	missense	probably damaging	0.99
R5490:Star	UTSW	8	25809917	missense	probably damaging	1.00
R6362:Star	UTSW	8	25811807	missense	probably benign	0.18
R6964:Star	UTSW	8	25811823	missense	probably benign	0.00
R8805:Star	UTSW	8	25809549	missense	probably benign	0.01
R8882:Star	UTSW	8	25812869	missense	probably benign	0.00
R9126:Star	UTSW	8	25812804	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- TGAGCTTCTGCCAGTGATG -3'
(R):5'- GTGAATGCAGTGGGAATCCC -3'

Sequencing Primer
(F):5'- TTGACCTGCAAGCAGAGC -3'
(R):5'- AATCCCGGCAGGCTTTGAG -3'

Posted On

2020-08-07