Mutagenetix > Incidental Mutation

Incidental Mutation 'R7924:Sorbs2'

643207

Institutional Source

Beutler Lab

Gene Symbol

Sorbs2

Ensembl Gene

ENSMUSG00000031626

Gene Name

sorbin and SH3 domain containing 2

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7924 (G1)

Quality Score

999

Status

Validated

Chromosome

Chromosomal Location

45507788-45827906 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 45795470 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 586 (S586L)

Ref Sequence

ENSEMBL: ENSMUSP00000128000 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067065] [ENSMUST00000067107] [ENSMUST00000125295] [ENSMUST00000130011] [ENSMUST00000132139] [ENSMUST00000135336] [ENSMUST00000138049] [ENSMUST00000139869] [ENSMUST00000153798] [ENSMUST00000171337] [ENSMUST00000211095]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000067065
AA Change: S451L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000070720
Gene: ENSMUSG00000031626
AA Change: S451L

Domain	Start	End	E-Value	Type
low complexity region	48	61	N/A	INTRINSIC
low complexity region	105	121	N/A	INTRINSIC
low complexity region	136	154	N/A	INTRINSIC
low complexity region	266	283	N/A	INTRINSIC
low complexity region	362	373	N/A	INTRINSIC
low complexity region	606	618	N/A	INTRINSIC
low complexity region	619	630	N/A	INTRINSIC
SH3	845	900	5.1e-23	SMART
low complexity region	901	916	N/A	INTRINSIC
SH3	920	977	3.9e-19	SMART
SH3	1023	1079	2.48e-12	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000067107
AA Change: S567L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000067641
Gene: ENSMUSG00000031626
AA Change: S567L

Domain	Start	End	E-Value	Type
Sorb	167	217	9.63e-34	SMART
low complexity region	264	277	N/A	INTRINSIC
low complexity region	382	399	N/A	INTRINSIC
low complexity region	478	489	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
low complexity region	735	746	N/A	INTRINSIC
SH3	962	1017	5.1e-23	SMART
low complexity region	1018	1033	N/A	INTRINSIC
SH3	1037	1094	3.9e-19	SMART
SH3	1140	1196	2.48e-12	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000125295
AA Change: S506L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000116768
Gene: ENSMUSG00000031626
AA Change: S506L

Domain	Start	End	E-Value	Type
Sorb	6	56	9.63e-34	SMART
low complexity region	103	116	N/A	INTRINSIC
low complexity region	160	176	N/A	INTRINSIC
low complexity region	191	209	N/A	INTRINSIC
low complexity region	321	338	N/A	INTRINSIC
low complexity region	417	428	N/A	INTRINSIC
low complexity region	661	673	N/A	INTRINSIC
low complexity region	674	685	N/A	INTRINSIC
SH3	900	955	5.1e-23	SMART
low complexity region	956	971	N/A	INTRINSIC
SH3	975	1032	3.9e-19	SMART
SH3	1078	1134	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130011

SMART Domains

Protein: ENSMUSP00000121619
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	113	163	1.01e-27	SMART
low complexity region	195	208	N/A	INTRINSIC
low complexity region	252	268	N/A	INTRINSIC
low complexity region	283	301	N/A	INTRINSIC
low complexity region	366	383	N/A	INTRINSIC
SH3	418	473	5.1e-23	SMART
low complexity region	474	489	N/A	INTRINSIC
SH3	493	550	3.9e-19	SMART
SH3	596	652	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000132139

SMART Domains

Protein: ENSMUSP00000123250
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	144	194	9.63e-34	SMART
low complexity region	241	254	N/A	INTRINSIC
low complexity region	298	314	N/A	INTRINSIC
low complexity region	329	347	N/A	INTRINSIC
low complexity region	431	448	N/A	INTRINSIC
SH3	483	538	5.1e-23	SMART
low complexity region	539	554	N/A	INTRINSIC
SH3	558	615	3.9e-19	SMART
SH3	636	707	2.16e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000135336
AA Change: S567L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114286
Gene: ENSMUSG00000031626
AA Change: S567L

Domain	Start	End	E-Value	Type
Sorb	167	217	9.63e-34	SMART
low complexity region	264	277	N/A	INTRINSIC
low complexity region	382	399	N/A	INTRINSIC
low complexity region	478	489	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
low complexity region	735	746	N/A	INTRINSIC
SH3	962	1017	5.1e-23	SMART
low complexity region	1018	1033	N/A	INTRINSIC
SH3	1037	1094	3.9e-19	SMART
SH3	1140	1196	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000138049

SMART Domains

Protein: ENSMUSP00000123503
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	167	217	1.01e-27	SMART
low complexity region	249	262	N/A	INTRINSIC
low complexity region	367	384	N/A	INTRINSIC
low complexity region	463	474	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000139869

SMART Domains

Protein: ENSMUSP00000121235
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	136	186	1.01e-27	SMART
low complexity region	218	231	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
SH3	389	444	5.1e-23	SMART
low complexity region	445	460	N/A	INTRINSIC
SH3	464	521	3.9e-19	SMART
SH3	567	623	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000140088

SMART Domains

Protein: ENSMUSP00000114158
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	2	25	9.17e-1	SMART
low complexity region	57	70	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000146627

SMART Domains

Protein: ENSMUSP00000120487
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
low complexity region	10	26	N/A	INTRINSIC
low complexity region	41	59	N/A	INTRINSIC
low complexity region	143	160	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000153798

SMART Domains

Protein: ENSMUSP00000118353
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	136	186	9.63e-34	SMART
low complexity region	233	246	N/A	INTRINSIC
low complexity region	351	368	N/A	INTRINSIC
SH3	403	458	5.1e-23	SMART
low complexity region	459	474	N/A	INTRINSIC
SH3	478	535	3.9e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000171337
AA Change: S586L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128000
Gene: ENSMUSG00000031626
AA Change: S586L

Domain	Start	End	E-Value	Type
Sorb	167	217	9.63e-34	SMART
low complexity region	264	277	N/A	INTRINSIC
low complexity region	401	418	N/A	INTRINSIC
low complexity region	497	508	N/A	INTRINSIC
low complexity region	741	753	N/A	INTRINSIC
low complexity region	754	765	N/A	INTRINSIC
SH3	980	1035	5.1e-23	SMART
low complexity region	1036	1051	N/A	INTRINSIC
SH3	1055	1112	3.9e-19	SMART
SH3	1158	1214	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000155858

SMART Domains

Protein: ENSMUSP00000122820
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
low complexity region	50	63	N/A	INTRINSIC
low complexity region	107	123	N/A	INTRINSIC
low complexity region	138	156	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000211095

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.7%

Validation Efficiency

99% (78/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arg and c-Abl represent the mammalian members of the Abelson family of non-receptor protein-tyrosine kinases. They interact with the Arg/Abl binding proteins via the SH3 domains present in the carboxy end of the latter group of proteins. This gene encodes the sorbin and SH3 domain containing 2 protein. It has three C-terminal SH3 domains and an N-terminal sorbin homology (SoHo) domain that interacts with lipid raft proteins. The subcellular localization of this protein in epithelial and cardiac muscle cells suggests that it functions as an adapter protein to assemble signaling complexes in stress fibers, and that it is a potential link between Abl family kinases and the actin cytoskeleton. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial postnatal lethality, reduced dendritic complexity, decreased excitatory synaptic transmission in dentate gyrus granule cells, a reduced acoustic startle response, and impaired long-term object recognition memory and contextual fear memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022B05Rik	T	A	8: 124,663,312		probably benign	Het
4930435E12Rik	G	A	16: 38,812,464	Q369*	probably null	Het
Acacb	A	G	5: 114,245,220	K2155E	possibly damaging	Het
Adgre5	G	A	8: 83,729,400	P256S	possibly damaging	Het
Adipor1	T	A	1: 134,425,993	V172D	probably damaging	Het
Ahsa1	T	C	12: 87,270,456		probably null	Het
Ankrd11	T	C	8: 122,895,902	I404V	possibly damaging	Het
Asxl3	G	A	18: 22,525,545	R2204Q	probably damaging	Het
Barhl2	A	G	5: 106,457,649	S65P	unknown	Het
Bbx	A	T	16: 50,224,308	L630H	probably damaging	Het
Cars	T	C	7: 143,569,871	T531A	possibly damaging	Het
Catsperb	T	A	12: 101,520,565	H450Q	probably benign	Het
Cdt1	T	C	8: 122,569,352	L135P	probably damaging	Het
Cemip	A	T	7: 83,943,715		probably benign	Het
Cfap206	T	A	4: 34,728,833	H24L	probably benign	Het
Cnga4	T	A	7: 105,407,821	V480E	probably benign	Het
Cnot1	ACG	A	8: 95,745,647		probably null	Het
Ctcfl	G	A	2: 173,113,656	T271I	possibly damaging	Het
Dlc1	T	C	8: 36,571,416	R1003G	probably benign	Het
Dnah7b	A	G	1: 46,219,430	D1927G	probably benign	Het
Dscc1	A	T	15: 55,082,176	D374E	probably benign	Het
Eci2	G	A	13: 34,993,070	Q69*	probably null	Het
Ep300	C	A	15: 81,649,502	P1920Q	unknown	Het
Epha5	A	G	5: 84,084,846	Y629H	possibly damaging	Het
Fam208b	A	T	13: 3,594,331	F129Y	possibly damaging	Het
Fat2	G	A	11: 55,262,787	T3533I	probably benign	Het
Fat3	T	C	9: 15,999,297	N1803S	probably damaging	Het
Fcrls	T	C	3: 87,259,533	Y51C	probably damaging	Het
G530012D18Rik	C	G	1: 85,577,214	D113E	unknown	Het
Gcnt2	A	T	13: 40,918,564	K228*	probably null	Het
Gucy2c	A	T	6: 136,763,055	V258E	probably benign	Het
Hecw1	C	A	13: 14,322,528	L298F	probably damaging	Het
Hydin	T	G	8: 110,418,471	V818G	possibly damaging	Het
Hykk	A	G	9: 54,922,240	Y131C	probably damaging	Het
Ick	T	C	9: 78,155,464	L260P	probably damaging	Het
Mpo	A	G	11: 87,794,840	D48G	probably damaging	Het
Mrps10	T	C	17: 47,378,283	*202Q	probably null	Het
Mrps14	T	C	1: 160,196,989	V30A	probably benign	Het
Mtmr7	G	A	8: 40,606,884	A62V	possibly damaging	Het
Muc2	G	T	7: 141,695,388	G497W	probably damaging	Het
Nnt	A	T	13: 119,386,645	V237D	probably damaging	Het
Nox4	G	T	7: 87,374,381	V492L	probably benign	Het
Obscn	C	G	11: 59,112,555	E1306Q	probably benign	Het
Olfr303	A	G	7: 86,394,730	I256T	probably damaging	Het
Olfr993	T	C	2: 85,414,219	Y220C	probably benign	Het
Pard3	A	G	8: 127,410,750	N861S	probably benign	Het
Pdlim4	G	A	11: 54,055,222	R230*	probably null	Het
Pinlyp	C	T	7: 24,542,125	V159M	possibly damaging	Het
Pla2g4d	T	C	2: 120,289,164		probably benign	Het
Plcb1	A	T	2: 135,359,693	T855S	probably benign	Het
Pot1a	T	A	6: 25,753,310	D409V	possibly damaging	Het
Prom1	T	C	5: 44,029,769	D382G	probably benign	Het
Prss16	A	T	13: 22,008,664	N83K	probably damaging	Het
Ptprn2	A	G	12: 116,841,264	D133G	probably benign	Het
Rasef	C	T	4: 73,740,929		probably null	Het
Rbak	A	G	5: 143,174,486	S271P	probably damaging	Het
Rbm20	A	T	19: 53,677,585	I60F	possibly damaging	Het
Rftn1	G	T	17: 50,047,380	A318D	probably damaging	Het
Rsf1	G	GACGGCCGCC	7: 97,579,909		probably benign	Het
Serpinb3c	A	G	1: 107,273,174	L171P	probably damaging	Het
Slc25a19	T	C	11: 115,615,550	Y211C	unknown	Het
Spesp1	A	T	9: 62,273,451	S58R	probably benign	Het
Spryd3	A	G	15: 102,118,327	I329T	probably benign	Het
St8sia2	G	A	7: 73,966,952	L113F	probably damaging	Het
Star	T	C	8: 25,809,855	I75T	possibly damaging	Het
Tdrd6	T	A	17: 43,627,806	I784F	possibly damaging	Het
Tsc22d4	A	G	5: 137,768,011	I144V	unknown	Het
Tspan8	T	C	10: 115,833,324		probably null	Het
Ttll9	C	T	2: 152,962,487		probably benign	Het
Ttn	T	C	2: 76,809,850		probably benign	Het
Ubr4	T	G	4: 139,467,276	L1160R	unknown	Het
Ufd1	A	G	16: 18,823,285	Y162C	possibly damaging	Het
Unc13c	A	T	9: 73,734,408	F1268I	probably benign	Het
Uvssa	T	C	5: 33,410,951	I561T	probably damaging	Het
Vmn2r15	A	T	5: 109,286,388	S817T	probably damaging	Het
Ybx1	T	C	4: 119,282,279	E173G	probably damaging	Het
Zc3h6	T	C	2: 129,015,480	S640P	possibly damaging	Het

Other mutations in Sorbs2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Sorbs2	APN	8	45799706	splice site	probably null
IGL00964:Sorbs2	APN	8	45795677	missense	probably damaging	0.97
IGL01101:Sorbs2	APN	8	45745423	missense	possibly damaging	0.93
IGL01586:Sorbs2	APN	8	45795594	missense	probably damaging	1.00
IGL01611:Sorbs2	APN	8	45795344	missense	probably null
IGL01662:Sorbs2	APN	8	45803829	splice site	probably benign
IGL01970:Sorbs2	APN	8	45745803	missense	probably damaging	1.00
IGL02169:Sorbs2	APN	8	45823749	missense	probably damaging	0.98
IGL02685:Sorbs2	APN	8	45803840	missense	probably benign	0.00
IGL03036:Sorbs2	APN	8	45782865	missense	probably benign
IGL03151:Sorbs2	APN	8	45799713	missense	probably benign	0.01
IGL03164:Sorbs2	APN	8	45782874	missense	probably benign	0.01
IGL03350:Sorbs2	APN	8	45805807	missense	probably damaging	0.99
BB001:Sorbs2	UTSW	8	45795470	missense	probably damaging	1.00
BB011:Sorbs2	UTSW	8	45795470	missense	probably damaging	1.00
R0058:Sorbs2	UTSW	8	45785254	splice site	probably null
R0058:Sorbs2	UTSW	8	45796263	missense	probably damaging	1.00
R0233:Sorbs2	UTSW	8	45769829	missense	probably damaging	1.00
R0233:Sorbs2	UTSW	8	45769829	missense	probably damaging	1.00
R0265:Sorbs2	UTSW	8	45785337	splice site	probably benign
R0306:Sorbs2	UTSW	8	45795730	missense	probably benign	0.00
R0308:Sorbs2	UTSW	8	45795130	nonsense	probably null
R0638:Sorbs2	UTSW	8	45796310	missense	probably damaging	1.00
R0940:Sorbs2	UTSW	8	45796502	missense	probably benign	0.39
R1110:Sorbs2	UTSW	8	45795730	missense	probably benign	0.13
R1160:Sorbs2	UTSW	8	45770576	missense	probably damaging	1.00
R1226:Sorbs2	UTSW	8	45795619	missense	probably damaging	1.00
R1271:Sorbs2	UTSW	8	45795967	missense	probably damaging	1.00
R1440:Sorbs2	UTSW	8	45789963	splice site	probably benign
R1514:Sorbs2	UTSW	8	45769829	missense	probably damaging	1.00
R1557:Sorbs2	UTSW	8	45759197	splice site	probably benign
R1582:Sorbs2	UTSW	8	45805777	missense	probably damaging	0.99
R1626:Sorbs2	UTSW	8	45769854	missense	probably damaging	1.00
R1700:Sorbs2	UTSW	8	45800984	missense	probably damaging	1.00
R1759:Sorbs2	UTSW	8	45763019	makesense	probably null
R1766:Sorbs2	UTSW	8	45770576	missense	probably damaging	1.00
R1782:Sorbs2	UTSW	8	45805696	missense	probably damaging	1.00
R1932:Sorbs2	UTSW	8	45796352	missense	probably benign	0.01
R1954:Sorbs2	UTSW	8	45745738	missense	probably benign	0.23
R2060:Sorbs2	UTSW	8	45775629	missense	probably damaging	1.00
R2149:Sorbs2	UTSW	8	45795443	missense	probably damaging	0.99
R2568:Sorbs2	UTSW	8	45795370	nonsense	probably null
R3812:Sorbs2	UTSW	8	45763030	missense	probably benign	0.00
R3831:Sorbs2	UTSW	8	45795095	missense	probably damaging	1.00
R3975:Sorbs2	UTSW	8	45772710	critical splice donor site	probably null
R4033:Sorbs2	UTSW	8	45775595	missense	probably damaging	1.00
R4714:Sorbs2	UTSW	8	45795293	missense	possibly damaging	0.89
R4828:Sorbs2	UTSW	8	45741615	intron	probably benign
R4926:Sorbs2	UTSW	8	45796217	missense	probably benign	0.03
R5027:Sorbs2	UTSW	8	45746534	splice site	probably null
R5118:Sorbs2	UTSW	8	45795785	missense	probably damaging	1.00
R5159:Sorbs2	UTSW	8	45795730	missense	probably benign	0.00
R5342:Sorbs2	UTSW	8	45796013	missense	probably damaging	0.96
R5390:Sorbs2	UTSW	8	45819741	missense	probably damaging	1.00
R5436:Sorbs2	UTSW	8	45796001	missense	probably damaging	1.00
R5655:Sorbs2	UTSW	8	45741581	critical splice donor site	probably null
R5687:Sorbs2	UTSW	8	45775632	missense	probably damaging	1.00
R5695:Sorbs2	UTSW	8	45792875	missense	probably benign	0.27
R5733:Sorbs2	UTSW	8	45759189	missense	probably damaging	1.00
R5928:Sorbs2	UTSW	8	45763183	missense	probably damaging	1.00
R5949:Sorbs2	UTSW	8	45769897	critical splice donor site	probably null
R6341:Sorbs2	UTSW	8	45770578	missense	probably damaging	1.00
R6620:Sorbs2	UTSW	8	45796176	missense	probably damaging	1.00
R6761:Sorbs2	UTSW	8	45772614	missense	probably damaging	1.00
R7349:Sorbs2	UTSW	8	45795823	nonsense	probably null
R7404:Sorbs2	UTSW	8	45759196	splice site	probably null
R7524:Sorbs2	UTSW	8	45795656	missense	probably benign	0.00
R7809:Sorbs2	UTSW	8	45745428	missense	possibly damaging	0.93
R7820:Sorbs2	UTSW	8	45796556	missense	probably null	0.16
R8285:Sorbs2	UTSW	8	45796067	missense	probably damaging	0.98
R8696:Sorbs2	UTSW	8	45795649	missense	possibly damaging	0.95
R8927:Sorbs2	UTSW	8	45795915	missense	probably damaging	1.00
R8928:Sorbs2	UTSW	8	45795915	missense	probably damaging	1.00
R9005:Sorbs2	UTSW	8	45795737	missense	probably benign
R9006:Sorbs2	UTSW	8	45805821	missense	possibly damaging	0.95
R9016:Sorbs2	UTSW	8	45795737	missense	probably benign
R9017:Sorbs2	UTSW	8	45795737	missense	probably benign
R9091:Sorbs2	UTSW	8	45795737	missense	probably benign
R9196:Sorbs2	UTSW	8	45805827	missense	probably benign	0.12
R9256:Sorbs2	UTSW	8	45795737	missense	probably benign
R9282:Sorbs2	UTSW	8	45795737	missense	probably benign
R9283:Sorbs2	UTSW	8	45795737	missense	probably benign
R9384:Sorbs2	UTSW	8	45805827	missense	probably benign	0.12
R9624:Sorbs2	UTSW	8	45775653	missense	possibly damaging	0.89
R9664:Sorbs2	UTSW	8	45823751	missense	probably benign	0.05
Z1176:Sorbs2	UTSW	8	45790025	missense	probably null	0.96
Z1177:Sorbs2	UTSW	8	45782959	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGACTCCAAAGAGAGCTGCC -3'
(R):5'- CCTCTTGGGACACAAACCATTTTG -3'

Sequencing Primer
(F):5'- AGAGAGCTGCCCCATGACATG -3'
(R):5'- GGGTTCTAGGGTTATAGGAGATAAC -3'

Posted On

2020-08-07