Incidental Mutation 'R7924:Bbx'
ID 643240
Institutional Source Beutler Lab
Gene Symbol Bbx
Ensembl Gene ENSMUSG00000022641
Gene Name bobby sox HMG box containing
Synonyms 5730403O13Rik, 5530401J07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7924 (G1)
Quality Score 999
Status Validated
Chromosome 16
Chromosomal Location 50191844-50432390 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 50224308 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 630 (L630H)
Ref Sequence ENSEMBL: ENSMUSP00000110132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066037] [ENSMUST00000089399] [ENSMUST00000089404] [ENSMUST00000114488] [ENSMUST00000138166]
AlphaFold Q8VBW5
Predicted Effect probably damaging
Transcript: ENSMUST00000066037
AA Change: L522H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066384
Gene: ENSMUSG00000022641
AA Change: L522H

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
Pfam:DUF2028 109 150 3.1e-22 PFAM
Pfam:DUF2028 140 214 4.4e-26 PFAM
low complexity region 216 230 N/A INTRINSIC
low complexity region 336 348 N/A INTRINSIC
low complexity region 415 432 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 561 566 N/A INTRINSIC
low complexity region 780 795 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000089399
AA Change: L630H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086821
Gene: ENSMUSG00000022641
AA Change: L630H

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
HMG 79 149 2.76e-15 SMART
Pfam:DUF2028 190 322 2.8e-64 PFAM
low complexity region 324 338 N/A INTRINSIC
low complexity region 444 456 N/A INTRINSIC
low complexity region 523 540 N/A INTRINSIC
low complexity region 636 647 N/A INTRINSIC
low complexity region 669 674 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000089404
AA Change: L630H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086826
Gene: ENSMUSG00000022641
AA Change: L630H

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
HMG 79 149 2.76e-15 SMART
Pfam:DUF2028 190 322 3.7e-64 PFAM
low complexity region 324 338 N/A INTRINSIC
low complexity region 444 456 N/A INTRINSIC
low complexity region 523 540 N/A INTRINSIC
low complexity region 636 647 N/A INTRINSIC
low complexity region 669 674 N/A INTRINSIC
low complexity region 838 853 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114488
AA Change: L630H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110132
Gene: ENSMUSG00000022641
AA Change: L630H

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
HMG 79 149 2.76e-15 SMART
Pfam:DUF2028 190 322 3.8e-64 PFAM
low complexity region 324 338 N/A INTRINSIC
low complexity region 444 456 N/A INTRINSIC
low complexity region 523 540 N/A INTRINSIC
low complexity region 636 647 N/A INTRINSIC
low complexity region 669 674 N/A INTRINSIC
low complexity region 723 734 N/A INTRINSIC
low complexity region 858 873 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138166
AA Change: L630H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119238
Gene: ENSMUSG00000022641
AA Change: L630H

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
HMG 79 149 2.76e-15 SMART
Pfam:DUF2028 190 335 9.2e-54 PFAM
low complexity region 444 456 N/A INTRINSIC
low complexity region 523 540 N/A INTRINSIC
low complexity region 636 647 N/A INTRINSIC
low complexity region 669 674 N/A INTRINSIC
low complexity region 723 734 N/A INTRINSIC
low complexity region 858 873 N/A INTRINSIC
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 99% (78/79)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele show increased IgA level, abnormal tooth morphology, and a reduction in heart weight, lean body mass, body length, long bone length, bone mineral density, and bone strength. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik T A 8: 124,663,312 probably benign Het
4930435E12Rik G A 16: 38,812,464 Q369* probably null Het
Acacb A G 5: 114,245,220 K2155E possibly damaging Het
Adgre5 G A 8: 83,729,400 P256S possibly damaging Het
Adipor1 T A 1: 134,425,993 V172D probably damaging Het
Ahsa1 T C 12: 87,270,456 probably null Het
Ankrd11 T C 8: 122,895,902 I404V possibly damaging Het
Asxl3 G A 18: 22,525,545 R2204Q probably damaging Het
Barhl2 A G 5: 106,457,649 S65P unknown Het
Cars T C 7: 143,569,871 T531A possibly damaging Het
Catsperb T A 12: 101,520,565 H450Q probably benign Het
Cdt1 T C 8: 122,569,352 L135P probably damaging Het
Cemip A T 7: 83,943,715 probably benign Het
Cfap206 T A 4: 34,728,833 H24L probably benign Het
Cnga4 T A 7: 105,407,821 V480E probably benign Het
Cnot1 ACG A 8: 95,745,647 probably null Het
Ctcfl G A 2: 173,113,656 T271I possibly damaging Het
Dlc1 T C 8: 36,571,416 R1003G probably benign Het
Dnah7b A G 1: 46,219,430 D1927G probably benign Het
Dscc1 A T 15: 55,082,176 D374E probably benign Het
Eci2 G A 13: 34,993,070 Q69* probably null Het
Ep300 C A 15: 81,649,502 P1920Q unknown Het
Epha5 A G 5: 84,084,846 Y629H possibly damaging Het
Fam208b A T 13: 3,594,331 F129Y possibly damaging Het
Fat2 G A 11: 55,262,787 T3533I probably benign Het
Fat3 T C 9: 15,999,297 N1803S probably damaging Het
Fcrls T C 3: 87,259,533 Y51C probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gcnt2 A T 13: 40,918,564 K228* probably null Het
Gucy2c A T 6: 136,763,055 V258E probably benign Het
Hecw1 C A 13: 14,322,528 L298F probably damaging Het
Hydin T G 8: 110,418,471 V818G possibly damaging Het
Hykk A G 9: 54,922,240 Y131C probably damaging Het
Ick T C 9: 78,155,464 L260P probably damaging Het
Mpo A G 11: 87,794,840 D48G probably damaging Het
Mrps10 T C 17: 47,378,283 *202Q probably null Het
Mrps14 T C 1: 160,196,989 V30A probably benign Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Muc2 G T 7: 141,695,388 G497W probably damaging Het
Nnt A T 13: 119,386,645 V237D probably damaging Het
Nox4 G T 7: 87,374,381 V492L probably benign Het
Obscn C G 11: 59,112,555 E1306Q probably benign Het
Olfr303 A G 7: 86,394,730 I256T probably damaging Het
Olfr993 T C 2: 85,414,219 Y220C probably benign Het
Pard3 A G 8: 127,410,750 N861S probably benign Het
Pdlim4 G A 11: 54,055,222 R230* probably null Het
Pinlyp C T 7: 24,542,125 V159M possibly damaging Het
Pla2g4d T C 2: 120,289,164 probably benign Het
Plcb1 A T 2: 135,359,693 T855S probably benign Het
Pot1a T A 6: 25,753,310 D409V possibly damaging Het
Prom1 T C 5: 44,029,769 D382G probably benign Het
Prss16 A T 13: 22,008,664 N83K probably damaging Het
Ptprn2 A G 12: 116,841,264 D133G probably benign Het
Rasef C T 4: 73,740,929 probably null Het
Rbak A G 5: 143,174,486 S271P probably damaging Het
Rbm20 A T 19: 53,677,585 I60F possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rsf1 G GACGGCCGCC 7: 97,579,909 probably benign Het
Serpinb3c A G 1: 107,273,174 L171P probably damaging Het
Slc25a19 T C 11: 115,615,550 Y211C unknown Het
Sorbs2 C T 8: 45,795,470 S586L probably damaging Het
Spesp1 A T 9: 62,273,451 S58R probably benign Het
Spryd3 A G 15: 102,118,327 I329T probably benign Het
St8sia2 G A 7: 73,966,952 L113F probably damaging Het
Star T C 8: 25,809,855 I75T possibly damaging Het
Tdrd6 T A 17: 43,627,806 I784F possibly damaging Het
Tsc22d4 A G 5: 137,768,011 I144V unknown Het
Tspan8 T C 10: 115,833,324 probably null Het
Ttll9 C T 2: 152,962,487 probably benign Het
Ttn T C 2: 76,809,850 probably benign Het
Ubr4 T G 4: 139,467,276 L1160R unknown Het
Ufd1 A G 16: 18,823,285 Y162C possibly damaging Het
Unc13c A T 9: 73,734,408 F1268I probably benign Het
Uvssa T C 5: 33,410,951 I561T probably damaging Het
Vmn2r15 A T 5: 109,286,388 S817T probably damaging Het
Ybx1 T C 4: 119,282,279 E173G probably damaging Het
Zc3h6 T C 2: 129,015,480 S640P possibly damaging Het
Other mutations in Bbx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01403:Bbx APN 16 50202513 missense probably benign 0.08
IGL01544:Bbx APN 16 50274777 nonsense probably null
IGL02073:Bbx APN 16 50202491 missense probably damaging 1.00
IGL02302:Bbx APN 16 50224915 missense probably damaging 1.00
IGL02566:Bbx APN 16 50223240 splice site probably benign
IGL02618:Bbx APN 16 50247798 missense probably damaging 1.00
IGL03187:Bbx APN 16 50274563 missense probably damaging 0.96
IGL03215:Bbx APN 16 50202572 missense probably damaging 1.00
IGL03295:Bbx APN 16 50224564 missense probably damaging 1.00
dalton UTSW 16 50210442 splice site probably null
BB001:Bbx UTSW 16 50224308 missense probably damaging 1.00
BB009:Bbx UTSW 16 50210443 critical splice donor site probably null
BB011:Bbx UTSW 16 50224308 missense probably damaging 1.00
BB019:Bbx UTSW 16 50210443 critical splice donor site probably null
PIT4378001:Bbx UTSW 16 50280473 nonsense probably null
R0024:Bbx UTSW 16 50224918 missense probably benign
R0024:Bbx UTSW 16 50224918 missense probably benign
R0071:Bbx UTSW 16 50280392 missense probably benign 0.32
R0071:Bbx UTSW 16 50280392 missense probably benign 0.32
R0143:Bbx UTSW 16 50280392 missense probably benign 0.32
R0144:Bbx UTSW 16 50280392 missense probably benign 0.32
R0374:Bbx UTSW 16 50280392 missense probably benign 0.32
R0532:Bbx UTSW 16 50266284 missense probably damaging 1.00
R0550:Bbx UTSW 16 50274533 splice site probably benign
R0762:Bbx UTSW 16 50225166 missense possibly damaging 0.94
R0881:Bbx UTSW 16 50220600 splice site probably benign
R1448:Bbx UTSW 16 50266270 nonsense probably null
R1916:Bbx UTSW 16 50266245 missense probably damaging 1.00
R1983:Bbx UTSW 16 50209117 missense possibly damaging 0.62
R2006:Bbx UTSW 16 50224395 missense possibly damaging 0.93
R2095:Bbx UTSW 16 50224689 missense possibly damaging 0.88
R2145:Bbx UTSW 16 50274544 splice site probably benign
R2475:Bbx UTSW 16 50220519 missense probably damaging 0.99
R2892:Bbx UTSW 16 50224741 missense probably damaging 1.00
R4130:Bbx UTSW 16 50224858 missense probably damaging 1.00
R4177:Bbx UTSW 16 50224858 missense probably damaging 1.00
R4486:Bbx UTSW 16 50200414 missense probably damaging 1.00
R4989:Bbx UTSW 16 50224738 missense probably damaging 1.00
R5005:Bbx UTSW 16 50266351 missense probably damaging 1.00
R5427:Bbx UTSW 16 50280497 missense probably benign
R5582:Bbx UTSW 16 50223356 missense probably damaging 1.00
R6063:Bbx UTSW 16 50251367 missense probably benign
R6216:Bbx UTSW 16 50251388 missense probably benign 0.00
R6246:Bbx UTSW 16 50224660 missense probably benign 0.04
R6618:Bbx UTSW 16 50266263 missense probably damaging 1.00
R6782:Bbx UTSW 16 50200565 missense probably benign 0.00
R7007:Bbx UTSW 16 50202488 missense possibly damaging 0.67
R7130:Bbx UTSW 16 50210442 splice site probably null
R7864:Bbx UTSW 16 50262434 missense probably damaging 0.99
R7932:Bbx UTSW 16 50210443 critical splice donor site probably null
R8079:Bbx UTSW 16 50210458 missense probably damaging 1.00
R8769:Bbx UTSW 16 50240864 missense probably damaging 1.00
R8833:Bbx UTSW 16 50225266 missense probably benign
R9087:Bbx UTSW 16 50274635 missense probably damaging 0.99
R9126:Bbx UTSW 16 50200450 missense probably damaging 1.00
R9272:Bbx UTSW 16 50202572 missense probably damaging 1.00
R9284:Bbx UTSW 16 50224660 missense probably benign 0.04
R9583:Bbx UTSW 16 50224557 missense possibly damaging 0.55
R9622:Bbx UTSW 16 50274659 missense probably damaging 0.98
R9798:Bbx UTSW 16 50224758 missense probably damaging 1.00
X0021:Bbx UTSW 16 50247805 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CCTGGCATTTCTCTATGATGGC -3'
(R):5'- GGCATAAAAGCAGAACCCTTG -3'

Sequencing Primer
(F):5'- AACCCTCCCTTAAGTGCTTGGAAG -3'
(R):5'- ACCCTTGACCCCTACCGAGG -3'
Posted On 2020-08-07