Incidental Mutation 'R7924:Tdrd6'
ID 643241
Institutional Source Beutler Lab
Gene Symbol Tdrd6
Ensembl Gene ENSMUSG00000040140
Gene Name tudor domain containing 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7924 (G1)
Quality Score 999
Status Validated
Chromosome 17
Chromosomal Location 43615335-43630299 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 43627806 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 784 (I784F)
Ref Sequence ENSEMBL: ENSMUSP00000131277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045717] [ENSMUST00000168073]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000045717
AA Change: I784F

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035338
Gene: ENSMUSG00000040140
AA Change: I784F

DomainStartEndE-ValueType
Pfam:TUDOR 14 133 9.9e-9 PFAM
low complexity region 166 187 N/A INTRINSIC
TUDOR 308 366 1.14e-2 SMART
low complexity region 452 463 N/A INTRINSIC
TUDOR 541 597 2.68e-8 SMART
TUDOR 817 877 2.56e-5 SMART
TUDOR 1037 1090 5.36e-8 SMART
TUDOR 1357 1415 2.19e-13 SMART
TUDOR 1569 1628 3.1e-13 SMART
low complexity region 1826 1842 N/A INTRINSIC
low complexity region 1866 1876 N/A INTRINSIC
TUDOR 2026 2083 9.45e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168073
AA Change: I784F

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131277
Gene: ENSMUSG00000040140
AA Change: I784F

DomainStartEndE-ValueType
Pfam:TUDOR 12 133 7.2e-9 PFAM
low complexity region 166 187 N/A INTRINSIC
TUDOR 308 366 1.14e-2 SMART
low complexity region 452 463 N/A INTRINSIC
TUDOR 541 597 2.68e-8 SMART
TUDOR 817 877 2.56e-5 SMART
TUDOR 1037 1090 5.36e-8 SMART
TUDOR 1357 1415 2.19e-13 SMART
TUDOR 1569 1628 3.1e-13 SMART
low complexity region 1826 1842 N/A INTRINSIC
low complexity region 1866 1876 N/A INTRINSIC
TUDOR 2027 2084 9.45e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tudor domain-containing protein and component of the chromatoid body, a type of ribonucleoprotein granule present in male germ cells. Studies in rodents have demonstrated a role for the encoded protein in spermiogenesis and the nonsense mediated decay (NMD) pathway. This protein is a major autoantigen in human patients with autoimmune polyendocrine syndrome type 1 (APS1). [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit male fertility associated with arrested spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik T A 8: 124,663,312 probably benign Het
4930435E12Rik G A 16: 38,812,464 Q369* probably null Het
Acacb A G 5: 114,245,220 K2155E possibly damaging Het
Adgre5 G A 8: 83,729,400 P256S possibly damaging Het
Adipor1 T A 1: 134,425,993 V172D probably damaging Het
Ahsa1 T C 12: 87,270,456 probably null Het
Ankrd11 T C 8: 122,895,902 I404V possibly damaging Het
Asxl3 G A 18: 22,525,545 R2204Q probably damaging Het
Barhl2 A G 5: 106,457,649 S65P unknown Het
Bbx A T 16: 50,224,308 L630H probably damaging Het
Cars T C 7: 143,569,871 T531A possibly damaging Het
Catsperb T A 12: 101,520,565 H450Q probably benign Het
Cdt1 T C 8: 122,569,352 L135P probably damaging Het
Cemip A T 7: 83,943,715 probably benign Het
Cfap206 T A 4: 34,728,833 H24L probably benign Het
Cnga4 T A 7: 105,407,821 V480E probably benign Het
Cnot1 ACG A 8: 95,745,647 probably null Het
Ctcfl G A 2: 173,113,656 T271I possibly damaging Het
Dlc1 T C 8: 36,571,416 R1003G probably benign Het
Dnah7b A G 1: 46,219,430 D1927G probably benign Het
Dscc1 A T 15: 55,082,176 D374E probably benign Het
Eci2 G A 13: 34,993,070 Q69* probably null Het
Ep300 C A 15: 81,649,502 P1920Q unknown Het
Epha5 A G 5: 84,084,846 Y629H possibly damaging Het
Fam208b A T 13: 3,594,331 F129Y possibly damaging Het
Fat2 G A 11: 55,262,787 T3533I probably benign Het
Fat3 T C 9: 15,999,297 N1803S probably damaging Het
Fcrls T C 3: 87,259,533 Y51C probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gcnt2 A T 13: 40,918,564 K228* probably null Het
Gucy2c A T 6: 136,763,055 V258E probably benign Het
Hecw1 C A 13: 14,322,528 L298F probably damaging Het
Hydin T G 8: 110,418,471 V818G possibly damaging Het
Hykk A G 9: 54,922,240 Y131C probably damaging Het
Ick T C 9: 78,155,464 L260P probably damaging Het
Mpo A G 11: 87,794,840 D48G probably damaging Het
Mrps10 T C 17: 47,378,283 *202Q probably null Het
Mrps14 T C 1: 160,196,989 V30A probably benign Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Muc2 G T 7: 141,695,388 G497W probably damaging Het
Nnt A T 13: 119,386,645 V237D probably damaging Het
Nox4 G T 7: 87,374,381 V492L probably benign Het
Obscn C G 11: 59,112,555 E1306Q probably benign Het
Olfr303 A G 7: 86,394,730 I256T probably damaging Het
Olfr993 T C 2: 85,414,219 Y220C probably benign Het
Pard3 A G 8: 127,410,750 N861S probably benign Het
Pdlim4 G A 11: 54,055,222 R230* probably null Het
Pinlyp C T 7: 24,542,125 V159M possibly damaging Het
Pla2g4d T C 2: 120,289,164 probably benign Het
Plcb1 A T 2: 135,359,693 T855S probably benign Het
Pot1a T A 6: 25,753,310 D409V possibly damaging Het
Prom1 T C 5: 44,029,769 D382G probably benign Het
Prss16 A T 13: 22,008,664 N83K probably damaging Het
Ptprn2 A G 12: 116,841,264 D133G probably benign Het
Rasef C T 4: 73,740,929 probably null Het
Rbak A G 5: 143,174,486 S271P probably damaging Het
Rbm20 A T 19: 53,677,585 I60F possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rsf1 G GACGGCCGCC 7: 97,579,909 probably benign Het
Serpinb3c A G 1: 107,273,174 L171P probably damaging Het
Slc25a19 T C 11: 115,615,550 Y211C unknown Het
Sorbs2 C T 8: 45,795,470 S586L probably damaging Het
Spesp1 A T 9: 62,273,451 S58R probably benign Het
Spryd3 A G 15: 102,118,327 I329T probably benign Het
St8sia2 G A 7: 73,966,952 L113F probably damaging Het
Star T C 8: 25,809,855 I75T possibly damaging Het
Tsc22d4 A G 5: 137,768,011 I144V unknown Het
Tspan8 T C 10: 115,833,324 probably null Het
Ttll9 C T 2: 152,962,487 probably benign Het
Ttn T C 2: 76,809,850 probably benign Het
Ubr4 T G 4: 139,467,276 L1160R unknown Het
Ufd1 A G 16: 18,823,285 Y162C possibly damaging Het
Unc13c A T 9: 73,734,408 F1268I probably benign Het
Uvssa T C 5: 33,410,951 I561T probably damaging Het
Vmn2r15 A T 5: 109,286,388 S817T probably damaging Het
Ybx1 T C 4: 119,282,279 E173G probably damaging Het
Zc3h6 T C 2: 129,015,480 S640P possibly damaging Het
Other mutations in Tdrd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Tdrd6 APN 17 43628160 missense probably damaging 0.96
IGL00844:Tdrd6 APN 17 43617196 missense probably benign
IGL00845:Tdrd6 APN 17 43626716 missense probably benign 0.06
IGL01558:Tdrd6 APN 17 43625768 missense probably damaging 1.00
IGL01558:Tdrd6 APN 17 43624766 missense probably benign 0.02
IGL01575:Tdrd6 APN 17 43627980 missense probably benign 0.00
IGL01812:Tdrd6 APN 17 43625174 missense probably benign 0.10
IGL02013:Tdrd6 APN 17 43625946 missense probably benign 0.00
IGL02067:Tdrd6 APN 17 43628209 missense probably damaging 1.00
IGL02112:Tdrd6 APN 17 43629351 missense probably damaging 1.00
IGL02159:Tdrd6 APN 17 43628390 missense probably damaging 1.00
IGL02226:Tdrd6 APN 17 43627202 missense probably damaging 1.00
IGL02416:Tdrd6 APN 17 43624738 missense probably benign 0.39
IGL02577:Tdrd6 APN 17 43626837 missense probably damaging 0.99
IGL02631:Tdrd6 APN 17 43626219 missense probably damaging 1.00
IGL02738:Tdrd6 APN 17 43620446 missense probably benign 0.06
IGL02792:Tdrd6 APN 17 43625027 missense probably benign
IGL02929:Tdrd6 APN 17 43629713 missense possibly damaging 0.61
IGL02934:Tdrd6 APN 17 43627887 missense probably benign 0.42
IGL02954:Tdrd6 APN 17 43627262 missense possibly damaging 0.82
IGL02969:Tdrd6 APN 17 43627549 missense probably damaging 0.98
IGL03006:Tdrd6 APN 17 43625432 missense probably damaging 1.00
IGL03155:Tdrd6 APN 17 43625507 missense probably damaging 1.00
IGL03219:Tdrd6 APN 17 43627964 missense probably benign 0.04
IGL03372:Tdrd6 APN 17 43625568 missense probably damaging 1.00
Edward UTSW 17 43627215 missense probably damaging 1.00
eliza UTSW 17 43628162 missense possibly damaging 0.90
Elizabeth UTSW 17 43624204 missense probably benign 0.00
henry UTSW 17 43628159 missense probably damaging 0.99
BB001:Tdrd6 UTSW 17 43627806 missense possibly damaging 0.94
BB011:Tdrd6 UTSW 17 43627806 missense possibly damaging 0.94
G1citation:Tdrd6 UTSW 17 43627215 missense probably damaging 1.00
R0030:Tdrd6 UTSW 17 43626591 missense possibly damaging 0.80
R0057:Tdrd6 UTSW 17 43617161 splice site probably benign
R0090:Tdrd6 UTSW 17 43628241 missense probably benign 0.00
R0270:Tdrd6 UTSW 17 43624308 missense probably benign
R0463:Tdrd6 UTSW 17 43625561 missense probably damaging 1.00
R0594:Tdrd6 UTSW 17 43629383 missense probably damaging 1.00
R0650:Tdrd6 UTSW 17 43628159 missense probably damaging 0.99
R1226:Tdrd6 UTSW 17 43626632 missense possibly damaging 0.63
R1309:Tdrd6 UTSW 17 43626621 missense probably benign
R1483:Tdrd6 UTSW 17 43627607 missense probably benign 0.31
R1561:Tdrd6 UTSW 17 43625624 missense probably damaging 0.96
R1574:Tdrd6 UTSW 17 43625624 missense probably damaging 0.96
R1647:Tdrd6 UTSW 17 43627109 missense possibly damaging 0.49
R1648:Tdrd6 UTSW 17 43627109 missense possibly damaging 0.49
R1723:Tdrd6 UTSW 17 43628327 missense possibly damaging 0.94
R1786:Tdrd6 UTSW 17 43624833 missense probably benign 0.01
R1819:Tdrd6 UTSW 17 43626551 missense probably benign 0.00
R1836:Tdrd6 UTSW 17 43625589 missense probably benign 0.03
R1892:Tdrd6 UTSW 17 43624805 missense probably benign 0.00
R1911:Tdrd6 UTSW 17 43627088 missense probably benign 0.21
R1936:Tdrd6 UTSW 17 43626467 missense probably damaging 0.98
R2005:Tdrd6 UTSW 17 43628655 missense probably damaging 1.00
R2006:Tdrd6 UTSW 17 43628655 missense probably damaging 1.00
R2132:Tdrd6 UTSW 17 43624833 missense probably benign 0.01
R2133:Tdrd6 UTSW 17 43624833 missense probably benign 0.01
R3010:Tdrd6 UTSW 17 43628042 missense probably benign 0.00
R4225:Tdrd6 UTSW 17 43625973 missense probably damaging 1.00
R4448:Tdrd6 UTSW 17 43629735 missense probably benign 0.26
R4449:Tdrd6 UTSW 17 43629735 missense probably benign 0.26
R4531:Tdrd6 UTSW 17 43628754 missense probably damaging 0.98
R4624:Tdrd6 UTSW 17 43625990 missense probably damaging 0.99
R4665:Tdrd6 UTSW 17 43624116 missense probably benign
R4676:Tdrd6 UTSW 17 43627610 missense probably damaging 0.96
R4785:Tdrd6 UTSW 17 43625576 missense probably damaging 1.00
R4912:Tdrd6 UTSW 17 43624327 missense probably benign 0.34
R5134:Tdrd6 UTSW 17 43626210 missense probably damaging 1.00
R5145:Tdrd6 UTSW 17 43626075 missense probably damaging 0.96
R5623:Tdrd6 UTSW 17 43629333 missense probably damaging 1.00
R5712:Tdrd6 UTSW 17 43626408 missense probably damaging 1.00
R5897:Tdrd6 UTSW 17 43624877 missense probably damaging 0.98
R5913:Tdrd6 UTSW 17 43628411 missense possibly damaging 0.73
R6142:Tdrd6 UTSW 17 43629482 missense probably benign 0.01
R6181:Tdrd6 UTSW 17 43628897 missense probably damaging 1.00
R6195:Tdrd6 UTSW 17 43629752 missense probably damaging 1.00
R6233:Tdrd6 UTSW 17 43629752 missense probably damaging 1.00
R6289:Tdrd6 UTSW 17 43624520 missense probably benign 0.01
R6315:Tdrd6 UTSW 17 43626338 missense probably benign 0.02
R6578:Tdrd6 UTSW 17 43628961 missense possibly damaging 0.65
R6645:Tdrd6 UTSW 17 43624532 missense probably benign 0.10
R6822:Tdrd6 UTSW 17 43627215 missense probably damaging 1.00
R7000:Tdrd6 UTSW 17 43627708 missense probably benign 0.28
R7075:Tdrd6 UTSW 17 43625174 missense probably benign 0.10
R7107:Tdrd6 UTSW 17 43624204 missense probably benign 0.00
R7381:Tdrd6 UTSW 17 43626093 missense probably benign 0.00
R7458:Tdrd6 UTSW 17 43625046 missense probably benign 0.02
R7461:Tdrd6 UTSW 17 43627926 missense probably benign 0.00
R7505:Tdrd6 UTSW 17 43627679 missense not run
R7583:Tdrd6 UTSW 17 43624238 missense probably benign 0.29
R7613:Tdrd6 UTSW 17 43627926 missense probably benign 0.00
R7723:Tdrd6 UTSW 17 43625960 missense probably benign 0.09
R7759:Tdrd6 UTSW 17 43624839 missense probably benign 0.00
R8002:Tdrd6 UTSW 17 43629819 missense probably damaging 0.98
R8134:Tdrd6 UTSW 17 43626173 missense probably damaging 0.99
R8231:Tdrd6 UTSW 17 43622135 missense probably damaging 1.00
R8242:Tdrd6 UTSW 17 43628930 missense probably damaging 1.00
R8542:Tdrd6 UTSW 17 43624892 missense probably damaging 1.00
R8713:Tdrd6 UTSW 17 43625019 missense probably benign 0.28
R9100:Tdrd6 UTSW 17 43625414 missense possibly damaging 0.76
R9201:Tdrd6 UTSW 17 43625670 missense probably benign 0.00
R9222:Tdrd6 UTSW 17 43628340 missense probably damaging 1.00
R9369:Tdrd6 UTSW 17 43625326 missense probably damaging 1.00
R9373:Tdrd6 UTSW 17 43628162 missense possibly damaging 0.90
R9384:Tdrd6 UTSW 17 43626892 missense probably benign 0.26
R9448:Tdrd6 UTSW 17 43625676 missense probably benign
R9534:Tdrd6 UTSW 17 43625619 missense probably benign 0.19
R9613:Tdrd6 UTSW 17 43628627 missense probably damaging 0.99
X0065:Tdrd6 UTSW 17 43625153 missense possibly damaging 0.80
X0065:Tdrd6 UTSW 17 43625993 missense probably damaging 0.99
Z1088:Tdrd6 UTSW 17 43626518 missense probably benign 0.23
Z1177:Tdrd6 UTSW 17 43627187 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGTAGATACCACGTCCCTGTC -3'
(R):5'- TCAGAAGCTTTGGCGGACAC -3'

Sequencing Primer
(F):5'- ACATGCTCTAACGAGTGTGC -3'
(R):5'- GGACACGGTCAGCCTTTCAAAC -3'
Posted On 2020-08-07