Incidental Mutation 'R7925:Wisp2'
ID 643255
Institutional Source Beutler Lab
Gene Symbol Wisp2
Ensembl Gene ENSMUSG00000027656
Gene Name WNT1 inducible signaling pathway protein 2
Synonyms rCop1, Crgr4, CCN5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7925 (G1)
Quality Score 999
Status Validated
Chromosome 2
Chromosomal Location 163820861-163833146 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 163829041 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Threonine at position 156 (R156T)
Ref Sequence ENSEMBL: ENSMUSP00000029188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029188]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000029188
AA Change: R156T

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029188
Gene: ENSMUSG00000027656
AA Change: R156T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IB 24 93 1.67e-16 SMART
VWC 100 163 5.9e-16 SMART
TSP1 195 239 9.68e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like (CT) domain. The encoded protein lacks the CT domain which is implicated in dimerization and heparin binding. It is 72% identical to the mouse protein at the amino acid level. This gene may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. Its expression in colon tumors is reduced while the other two WISP members are overexpressed in colon tumors. It is expressed at high levels in bone tissue, and may play an important role in modulating bone turnover. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viabe and overtly normal with no adult bone phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,994,082 Q392* probably null Het
4933427D14Rik A C 11: 72,180,501 L473V probably benign Het
A930002H24Rik A T 17: 63,863,397 V132E unknown Het
Abcc2 A G 19: 43,807,112 I436V probably benign Het
Ahr G A 12: 35,515,068 Q103* probably null Het
Asb15 T A 6: 24,562,724 H228Q probably benign Het
Asphd1 T A 7: 126,948,456 Y225F probably damaging Het
Atp2c1 A G 9: 105,442,770 M468T possibly damaging Het
BC030499 T C 11: 78,291,623 L86P probably damaging Het
Brca1 A G 11: 101,508,146 I1540T probably benign Het
Cdh20 A T 1: 104,984,748 I576F probably damaging Het
Chst11 T A 10: 83,190,954 S72T probably damaging Het
Cldn17 T G 16: 88,506,645 K65N probably damaging Het
Cldn22 T C 8: 47,825,187 I220T probably benign Het
Coasy T G 11: 101,083,696 D229E probably benign Het
Colec10 T C 15: 54,462,371 V199A probably damaging Het
Cpn2 G T 16: 30,260,801 D27E probably damaging Het
F5 T A 1: 164,176,366 probably null Het
Fat3 C T 9: 16,031,360 V1239I possibly damaging Het
Fbxl16 A G 17: 25,816,906 N159S probably benign Het
Fhad1 A G 4: 141,954,187 I514T probably damaging Het
Fras1 A G 5: 96,781,584 K3949R probably damaging Het
Gm8126 A G 14: 43,261,566 N164S probably damaging Het
Grm3 T A 5: 9,589,880 E55V probably benign Het
Itgbl1 G A 14: 123,973,323 D478N possibly damaging Het
Kcnt2 T A 1: 140,354,509 Y77* probably null Het
Kdm4c T C 4: 74,404,821 S997P probably damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lrrc28 T C 7: 67,619,109 Y71C probably damaging Het
Lrrc45 T A 11: 120,715,880 W203R probably benign Het
Lrrc66 A T 5: 73,608,492 C403S possibly damaging Het
Ly6g6e A T 17: 35,077,918 E45V probably damaging Het
Mgam C T 6: 40,759,051 T1574I probably damaging Het
Msrb2 A T 2: 19,383,280 M80L probably benign Het
Musk T A 4: 58,367,513 L592Q probably damaging Het
Nlrp4a C A 7: 26,450,586 N539K probably benign Het
Obscn C G 11: 59,112,555 E1306Q probably benign Het
Olfr1006 T C 2: 85,674,563 E196G Het
Olfr1291-ps1 A G 2: 111,499,821 S190G probably damaging Het
Olfr355 A G 2: 36,927,359 F252L possibly damaging Het
Olfr388-ps1 A G 11: 73,724,536 S163P unknown Het
Opalin T A 19: 41,063,803 *144C probably null Het
Pdgfra T A 5: 75,192,418 probably benign Het
Pgam2 T A 11: 5,803,007 H196L possibly damaging Het
Pgls T C 8: 71,592,352 S46P probably damaging Het
Prrc2b A G 2: 32,204,115 E503G probably damaging Het
Prss45 T C 9: 110,841,035 L304P unknown Het
Rbm20 T A 19: 53,813,322 V87D probably damaging Het
Serpinb8 T C 1: 107,598,985 L85S probably benign Het
Sf3a2 ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT 10: 80,804,437 probably benign Het
Sh2b2 A T 5: 136,224,261 H352Q probably benign Het
Slc6a17 T C 3: 107,495,740 I124V probably damaging Het
Smim10l1 G A 6: 133,105,582 V31M probably damaging Het
Snx10 T C 6: 51,580,321 S78P probably benign Het
Stard10 T C 7: 101,342,631 V187A probably damaging Het
Svil C A 18: 5,118,357 D2146E probably benign Het
Tsc22d4 A G 5: 137,751,365 D301G probably null Het
Ube3c T A 5: 29,646,431 I752N probably damaging Het
Wwc1 T C 11: 35,844,163 M962V probably benign Het
Other mutations in Wisp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Wisp2 APN 2 163829022 missense probably damaging 1.00
BB002:Wisp2 UTSW 2 163829041 missense possibly damaging 0.82
BB012:Wisp2 UTSW 2 163829041 missense possibly damaging 0.82
R0336:Wisp2 UTSW 2 163832322 missense probably damaging 0.98
R0600:Wisp2 UTSW 2 163825313 missense probably damaging 1.00
R1241:Wisp2 UTSW 2 163829077 missense unknown
R1779:Wisp2 UTSW 2 163828986 missense probably damaging 1.00
R2921:Wisp2 UTSW 2 163832346 missense probably benign 0.11
R2923:Wisp2 UTSW 2 163832346 missense probably benign 0.11
R4049:Wisp2 UTSW 2 163828984 missense probably damaging 1.00
R4344:Wisp2 UTSW 2 163828986 missense probably damaging 1.00
R5409:Wisp2 UTSW 2 163825238 missense probably damaging 1.00
R5529:Wisp2 UTSW 2 163825359 critical splice donor site probably null
R5663:Wisp2 UTSW 2 163825253 missense probably damaging 1.00
R6401:Wisp2 UTSW 2 163829026 missense probably benign 0.45
R6685:Wisp2 UTSW 2 163828948 missense possibly damaging 0.87
R7242:Wisp2 UTSW 2 163828852 missense probably benign 0.27
R8066:Wisp2 UTSW 2 163828942 missense probably damaging 1.00
R8701:Wisp2 UTSW 2 163828866 missense probably damaging 1.00
R8962:Wisp2 UTSW 2 163825240 nonsense probably null
R9215:Wisp2 UTSW 2 163829046 missense probably damaging 1.00
R9656:Wisp2 UTSW 2 163829065 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTGTGCAGTCGAAGAGGATGAC -3'
(R):5'- AGCCACCTGAACTTGAACTATG -3'

Sequencing Primer
(F):5'- CGGGAGCTGTGAGGTGAATG -3'
(R):5'- ATACCATGTGCATGCCTGG -3'
Posted On 2020-08-07