Incidental Mutation 'R7925:Pgam2'
ID643284
Institutional Source Beutler Lab
Gene Symbol Pgam2
Ensembl Gene ENSMUSG00000020475
Gene Namephosphoglycerate mutase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.381) question?
Stock #R7925 (G1)
Quality Score999
Status Validated
Chromosome11
Chromosomal Location5801640-5803733 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5803007 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 196 (H196L)
Ref Sequence ENSEMBL: ENSMUSP00000020768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020768] [ENSMUST00000020769] [ENSMUST00000102928] [ENSMUST00000109845]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020768
AA Change: H196L

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020768
Gene: ENSMUSG00000020475
AA Change: H196L

DomainStartEndE-ValueType
PGAM 5 193 8.71e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000020769
SMART Domains Protein: ENSMUSP00000020769
Gene: ENSMUSG00000020476

DomainStartEndE-ValueType
ADF 7 133 2.39e-31 SMART
coiled coil region 180 233 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
SH3 380 436 1.62e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102928
SMART Domains Protein: ENSMUSP00000099992
Gene: ENSMUSG00000020476

DomainStartEndE-ValueType
ADF 7 133 2.39e-31 SMART
coiled coil region 180 233 N/A INTRINSIC
low complexity region 331 342 N/A INTRINSIC
SH3 377 433 1.62e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109845
SMART Domains Protein: ENSMUSP00000105471
Gene: ENSMUSG00000020476

DomainStartEndE-ValueType
ADF 7 133 2.39e-31 SMART
coiled coil region 180 233 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
SH3 376 432 1.62e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphoglycerate mutase (PGAM) catalyzes the reversible reaction of 3-phosphoglycerate (3-PGA) to 2-phosphoglycerate (2-PGA) in the glycolytic pathway. The PGAM is a dimeric enzyme containing, in different tissues, different proportions of a slow-migrating muscle (MM) isozyme, a fast-migrating brain (BB) isozyme, and a hybrid form (MB). This gene encodes muscle-specific PGAM subunit. Mutations in this gene cause muscle phosphoglycerate mutase eficiency, also known as glycogen storage disease X. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,994,082 Q392* probably null Het
4933427D14Rik A C 11: 72,180,501 L473V probably benign Het
A930002H24Rik A T 17: 63,863,397 V132E unknown Het
Abcc2 A G 19: 43,807,112 I436V probably benign Het
Ahr G A 12: 35,515,068 Q103* probably null Het
Asb15 T A 6: 24,562,724 H228Q probably benign Het
Asphd1 T A 7: 126,948,456 Y225F probably damaging Het
Atp2c1 A G 9: 105,442,770 M468T possibly damaging Het
BC030499 T C 11: 78,291,623 L86P probably damaging Het
Brca1 A G 11: 101,508,146 I1540T probably benign Het
Cdh20 A T 1: 104,984,748 I576F probably damaging Het
Chst11 T A 10: 83,190,954 S72T probably damaging Het
Cldn17 T G 16: 88,506,645 K65N probably damaging Het
Cldn22 T C 8: 47,825,187 I220T probably benign Het
Coasy T G 11: 101,083,696 D229E probably benign Het
Colec10 T C 15: 54,462,371 V199A probably damaging Het
Cpn2 G T 16: 30,260,801 D27E probably damaging Het
F5 T A 1: 164,176,366 probably null Het
Fat3 C T 9: 16,031,360 V1239I possibly damaging Het
Fbxl16 A G 17: 25,816,906 N159S probably benign Het
Fhad1 A G 4: 141,954,187 I514T probably damaging Het
Fras1 A G 5: 96,781,584 K3949R probably damaging Het
Gm8126 A G 14: 43,261,566 N164S probably damaging Het
Grm3 T A 5: 9,589,880 E55V probably benign Het
Itgbl1 G A 14: 123,973,323 D478N possibly damaging Het
Kcnt2 T A 1: 140,354,509 Y77* probably null Het
Kdm4c T C 4: 74,404,821 S997P probably damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lrrc28 T C 7: 67,619,109 Y71C probably damaging Het
Lrrc45 T A 11: 120,715,880 W203R probably benign Het
Lrrc66 A T 5: 73,608,492 C403S possibly damaging Het
Ly6g6e A T 17: 35,077,918 E45V probably damaging Het
Mgam C T 6: 40,759,051 T1574I probably damaging Het
Msrb2 A T 2: 19,383,280 M80L probably benign Het
Musk T A 4: 58,367,513 L592Q probably damaging Het
Nlrp4a C A 7: 26,450,586 N539K probably benign Het
Obscn C G 11: 59,112,555 E1306Q probably benign Het
Olfr1006 T C 2: 85,674,563 E196G Het
Olfr1291-ps1 A G 2: 111,499,821 S190G probably damaging Het
Olfr355 A G 2: 36,927,359 F252L possibly damaging Het
Olfr388-ps1 A G 11: 73,724,536 S163P unknown Het
Opalin T A 19: 41,063,803 *144C probably null Het
Pdgfra T A 5: 75,192,418 probably benign Het
Pgls T C 8: 71,592,352 S46P probably damaging Het
Prrc2b A G 2: 32,204,115 E503G probably damaging Het
Prss45 T C 9: 110,841,035 L304P unknown Het
Rbm20 T A 19: 53,813,322 V87D probably damaging Het
Serpinb8 T C 1: 107,598,985 L85S probably benign Het
Sf3a2 ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT 10: 80,804,437 probably benign Het
Sh2b2 A T 5: 136,224,261 H352Q probably benign Het
Slc6a17 T C 3: 107,495,740 I124V probably damaging Het
Smim10l1 G A 6: 133,105,582 V31M probably damaging Het
Snx10 T C 6: 51,580,321 S78P probably benign Het
Stard10 T C 7: 101,342,631 V187A probably damaging Het
Svil C A 18: 5,118,357 D2146E probably benign Het
Tsc22d4 A G 5: 137,751,365 D301G probably null Het
Ube3c T A 5: 29,646,431 I752N probably damaging Het
Wisp2 G C 2: 163,829,041 R156T possibly damaging Het
Wwc1 T C 11: 35,844,163 M962V probably benign Het
Other mutations in Pgam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Pgam2 APN 11 5803442 missense probably damaging 1.00
BB002:Pgam2 UTSW 11 5803007 missense possibly damaging 0.91
BB012:Pgam2 UTSW 11 5803007 missense possibly damaging 0.91
R1557:Pgam2 UTSW 11 5801773 missense possibly damaging 0.82
R2240:Pgam2 UTSW 11 5803265 unclassified probably benign
R2244:Pgam2 UTSW 11 5801723 missense probably benign 0.05
R5810:Pgam2 UTSW 11 5803417 missense possibly damaging 0.77
R7229:Pgam2 UTSW 11 5803013 missense probably damaging 1.00
R7654:Pgam2 UTSW 11 5803351 missense probably null 0.07
Predicted Primers PCR Primer
(F):5'- TATGATCAGCTCCTGTGGGG -3'
(R):5'- AGCGAAATGTTCCTGTGCC -3'

Sequencing Primer
(F):5'- TGGGGTGCCTCAGCTATGC -3'
(R):5'- GAAATGTTCCTGTGCCCTTGTC -3'
Posted On2020-08-07