Incidental Mutation 'R7925:Wwc1'
ID643285
Institutional Source Beutler Lab
Gene Symbol Wwc1
Ensembl Gene ENSMUSG00000018849
Gene NameWW, C2 and coiled-coil domain containing 1
SynonymsKibra
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_170779.1; MGI: 2388637

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7925 (G1)
Quality Score999
Status Validated
Chromosome11
Chromosomal Location35838400-35980527 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35844163 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 962 (M962V)
Ref Sequence ENSEMBL: ENSMUSP00000018993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018993]
Predicted Effect probably benign
Transcript: ENSMUST00000018993
AA Change: M962V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000018993
Gene: ENSMUSG00000018849
AA Change: M962V

DomainStartEndE-ValueType
WW 7 39 7.96e-12 SMART
WW 54 86 5.22e-7 SMART
coiled coil region 107 133 N/A INTRINSIC
low complexity region 139 153 N/A INTRINSIC
coiled coil region 158 193 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
coiled coil region 294 330 N/A INTRINSIC
low complexity region 341 353 N/A INTRINSIC
coiled coil region 360 431 N/A INTRINSIC
low complexity region 527 549 N/A INTRINSIC
low complexity region 645 657 N/A INTRINSIC
Pfam:C2 674 784 8.3e-7 PFAM
low complexity region 842 860 N/A INTRINSIC
coiled coil region 994 1024 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (59/59)
MGI Phenotype Strain: 5301655
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic phosphoprotein that interacts with PRKC-zeta and dynein light chain-1. Alleles of this gene have been found that enhance memory in some individuals. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired adult synaptic plasticity and fear-based conditioning. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(1) Gene trapped(10

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,994,082 Q392* probably null Het
4933427D14Rik A C 11: 72,180,501 L473V probably benign Het
A930002H24Rik A T 17: 63,863,397 V132E unknown Het
Abcc2 A G 19: 43,807,112 I436V probably benign Het
Ahr G A 12: 35,515,068 Q103* probably null Het
Asb15 T A 6: 24,562,724 H228Q probably benign Het
Asphd1 T A 7: 126,948,456 Y225F probably damaging Het
Atp2c1 A G 9: 105,442,770 M468T possibly damaging Het
BC030499 T C 11: 78,291,623 L86P probably damaging Het
Brca1 A G 11: 101,508,146 I1540T probably benign Het
Cdh20 A T 1: 104,984,748 I576F probably damaging Het
Chst11 T A 10: 83,190,954 S72T probably damaging Het
Cldn17 T G 16: 88,506,645 K65N probably damaging Het
Cldn22 T C 8: 47,825,187 I220T probably benign Het
Coasy T G 11: 101,083,696 D229E probably benign Het
Colec10 T C 15: 54,462,371 V199A probably damaging Het
Cpn2 G T 16: 30,260,801 D27E probably damaging Het
F5 T A 1: 164,176,366 probably null Het
Fat3 C T 9: 16,031,360 V1239I possibly damaging Het
Fbxl16 A G 17: 25,816,906 N159S probably benign Het
Fhad1 A G 4: 141,954,187 I514T probably damaging Het
Fras1 A G 5: 96,781,584 K3949R probably damaging Het
Gm8126 A G 14: 43,261,566 N164S probably damaging Het
Grm3 T A 5: 9,589,880 E55V probably benign Het
Itgbl1 G A 14: 123,973,323 D478N possibly damaging Het
Kcnt2 T A 1: 140,354,509 Y77* probably null Het
Kdm4c T C 4: 74,404,821 S997P probably damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lrrc28 T C 7: 67,619,109 Y71C probably damaging Het
Lrrc45 T A 11: 120,715,880 W203R probably benign Het
Lrrc66 A T 5: 73,608,492 C403S possibly damaging Het
Ly6g6e A T 17: 35,077,918 E45V probably damaging Het
Mgam C T 6: 40,759,051 T1574I probably damaging Het
Msrb2 A T 2: 19,383,280 M80L probably benign Het
Musk T A 4: 58,367,513 L592Q probably damaging Het
Nlrp4a C A 7: 26,450,586 N539K probably benign Het
Obscn C G 11: 59,112,555 E1306Q probably benign Het
Olfr1006 T C 2: 85,674,563 E196G Het
Olfr1291-ps1 A G 2: 111,499,821 S190G probably damaging Het
Olfr355 A G 2: 36,927,359 F252L possibly damaging Het
Olfr388-ps1 A G 11: 73,724,536 S163P unknown Het
Opalin T A 19: 41,063,803 *144C probably null Het
Pdgfra T A 5: 75,192,418 probably benign Het
Pgam2 T A 11: 5,803,007 H196L possibly damaging Het
Pgls T C 8: 71,592,352 S46P probably damaging Het
Prrc2b A G 2: 32,204,115 E503G probably damaging Het
Prss45 T C 9: 110,841,035 L304P unknown Het
Rbm20 T A 19: 53,813,322 V87D probably damaging Het
Serpinb8 T C 1: 107,598,985 L85S probably benign Het
Sf3a2 ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT 10: 80,804,437 probably benign Het
Sh2b2 A T 5: 136,224,261 H352Q probably benign Het
Slc6a17 T C 3: 107,495,740 I124V probably damaging Het
Smim10l1 G A 6: 133,105,582 V31M probably damaging Het
Snx10 T C 6: 51,580,321 S78P probably benign Het
Stard10 T C 7: 101,342,631 V187A probably damaging Het
Svil C A 18: 5,118,357 D2146E probably benign Het
Tsc22d4 A G 5: 137,751,365 D301G probably null Het
Ube3c T A 5: 29,646,431 I752N probably damaging Het
Wisp2 G C 2: 163,829,041 R156T possibly damaging Het
Other mutations in Wwc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Wwc1 APN 11 35844202 missense possibly damaging 0.82
IGL01161:Wwc1 APN 11 35867276 missense probably damaging 1.00
IGL01401:Wwc1 APN 11 35898618 critical splice donor site probably null
IGL01771:Wwc1 APN 11 35853358 critical splice donor site probably null
IGL01804:Wwc1 APN 11 35841924 missense probably damaging 1.00
IGL02079:Wwc1 APN 11 35876058 missense probably damaging 1.00
IGL02201:Wwc1 APN 11 35844151 splice site probably benign
IGL03376:Wwc1 APN 11 35852294 missense possibly damaging 0.80
IGL03403:Wwc1 APN 11 35915284 missense possibly damaging 0.94
BB002:Wwc1 UTSW 11 35844163 missense probably benign 0.00
BB012:Wwc1 UTSW 11 35844163 missense probably benign 0.00
P0008:Wwc1 UTSW 11 35853351 splice site probably benign
R0277:Wwc1 UTSW 11 35852348 missense probably damaging 0.99
R0321:Wwc1 UTSW 11 35841810 nonsense probably null
R0323:Wwc1 UTSW 11 35852348 missense probably damaging 0.99
R0629:Wwc1 UTSW 11 35853472 missense probably benign 0.18
R1302:Wwc1 UTSW 11 35844157 missense probably damaging 1.00
R1769:Wwc1 UTSW 11 35861844 missense probably benign
R1870:Wwc1 UTSW 11 35861945 missense probably damaging 1.00
R2000:Wwc1 UTSW 11 35876547 missense probably damaging 1.00
R2074:Wwc1 UTSW 11 35889353 missense possibly damaging 0.62
R2138:Wwc1 UTSW 11 35841887 missense possibly damaging 0.47
R2140:Wwc1 UTSW 11 35870528 missense probably benign 0.01
R2680:Wwc1 UTSW 11 35875929 missense probably benign 0.23
R3864:Wwc1 UTSW 11 35910316 missense probably damaging 1.00
R4773:Wwc1 UTSW 11 35867296 missense probably benign
R4926:Wwc1 UTSW 11 35889400 missense probably benign 0.17
R4980:Wwc1 UTSW 11 35888103 missense possibly damaging 0.93
R4990:Wwc1 UTSW 11 35876566 missense probably benign 0.00
R5044:Wwc1 UTSW 11 35883345 missense probably benign 0.45
R5238:Wwc1 UTSW 11 35875896 missense probably benign 0.02
R5421:Wwc1 UTSW 11 35876063 missense possibly damaging 0.81
R5421:Wwc1 UTSW 11 35910296 missense possibly damaging 0.93
R5461:Wwc1 UTSW 11 35867372 missense probably damaging 1.00
R5705:Wwc1 UTSW 11 35876596 missense probably damaging 0.99
R5847:Wwc1 UTSW 11 35867326 missense probably damaging 1.00
R5993:Wwc1 UTSW 11 35852336 missense probably benign 0.17
R6006:Wwc1 UTSW 11 35870982 missense probably null 1.00
R6006:Wwc1 UTSW 11 35889273 missense probably damaging 0.98
R6516:Wwc1 UTSW 11 35867302 missense probably benign 0.05
R6519:Wwc1 UTSW 11 35853437 missense probably benign 0.04
R6520:Wwc1 UTSW 11 35853437 missense probably benign 0.04
R6525:Wwc1 UTSW 11 35853437 missense probably benign 0.04
R6526:Wwc1 UTSW 11 35853437 missense probably benign 0.04
R6527:Wwc1 UTSW 11 35853437 missense probably benign 0.04
R6528:Wwc1 UTSW 11 35853437 missense probably benign 0.04
R7060:Wwc1 UTSW 11 35915176 missense possibly damaging 0.74
R7156:Wwc1 UTSW 11 35897374 critical splice donor site probably null
R7448:Wwc1 UTSW 11 35875706 missense probably benign
R7586:Wwc1 UTSW 11 35844195 missense possibly damaging 0.69
R7793:Wwc1 UTSW 11 35869109 missense probably benign 0.21
R8296:Wwc1 UTSW 11 35870557 splice site probably benign
R8369:Wwc1 UTSW 11 35867371 missense probably damaging 1.00
R8735:Wwc1 UTSW 11 35883407 missense probably damaging 1.00
R8804:Wwc1 UTSW 11 35883317 missense probably benign 0.30
X0025:Wwc1 UTSW 11 35876040 missense possibly damaging 0.95
Z1088:Wwc1 UTSW 11 35883482 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CGAGAGGTGAGTGCATCGTA -3'
(R):5'- GGGAGGTGATCTCTTCCTGT -3'

Sequencing Primer
(F):5'- TCCAGAGTGAACATCTGTCTG -3'
(R):5'- CTAAACCGCAGTGACAGT -3'
Posted On2020-08-07