Incidental Mutation 'R7925:Coasy'
ID643290
Institutional Source Beutler Lab
Gene Symbol Coasy
Ensembl Gene ENSMUSG00000001755
Gene NameCoenzyme A synthase
SynonymsPpat, 1300003G02Rik, Ukr1, Dpck
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #R7925 (G1)
Quality Score999
Status Validated
Chromosome11
Chromosomal Location101082565-101086619 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 101083696 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 229 (D229E)
Ref Sequence ENSEMBL: ENSMUSP00000001806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001806] [ENSMUST00000017945] [ENSMUST00000019445] [ENSMUST00000107302] [ENSMUST00000107303] [ENSMUST00000107308] [ENSMUST00000149597]
PDB Structure Crystal structure of Bifunctional coenzyme A synthase (CoA synthase): (18044849) from MUS MUSCULUS at 1.70 A resolution [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000001806
AA Change: D229E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001806
Gene: ENSMUSG00000001755
AA Change: D229E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 159 170 N/A INTRINSIC
Pfam:CTP_transf_2 194 338 1.4e-11 PFAM
Pfam:CoaE 358 536 5.6e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000017945
SMART Domains Protein: ENSMUSP00000017945
Gene: ENSMUSG00000017801

DomainStartEndE-ValueType
low complexity region 18 41 N/A INTRINSIC
HLH 135 193 8.13e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000019445
SMART Domains Protein: ENSMUSP00000019445
Gene: ENSMUSG00000019301

DomainStartEndE-ValueType
Pfam:KR 4 174 3.5e-9 PFAM
Pfam:adh_short 4 200 1.6e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107302
SMART Domains Protein: ENSMUSP00000102923
Gene: ENSMUSG00000017801

DomainStartEndE-ValueType
HLH 81 139 8.13e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107303
SMART Domains Protein: ENSMUSP00000102924
Gene: ENSMUSG00000017801

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
HLH 51 109 8.13e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107308
AA Change: D229E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102929
Gene: ENSMUSG00000001755
AA Change: D229E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 159 170 N/A INTRINSIC
Pfam:CTP_transf_like 194 338 5.3e-11 PFAM
Pfam:CoaE 358 536 1.7e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149597
SMART Domains Protein: ENSMUSP00000121600
Gene: ENSMUSG00000017801

DomainStartEndE-ValueType
low complexity region 18 41 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
Pfam:HLH 100 127 2.5e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: This gene encodes the bifunctional protein coenzyme A (CoA) synthase which carries out the last two steps in the biosynthesis of CoA from pantothenic acid (vitamin B5). The phosphopantetheine adenylyltransferase domain of this protein catalyzes the conversion of phosphopantetheine into dephospho-CoA while its dephospho-CoA kinase domain completes the final step by phosphorylating dephospho-CoA to form CoA. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,994,082 Q392* probably null Het
4933427D14Rik A C 11: 72,180,501 L473V probably benign Het
A930002H24Rik A T 17: 63,863,397 V132E unknown Het
Abcc2 A G 19: 43,807,112 I436V probably benign Het
Ahr G A 12: 35,515,068 Q103* probably null Het
Asb15 T A 6: 24,562,724 H228Q probably benign Het
Asphd1 T A 7: 126,948,456 Y225F probably damaging Het
Atp2c1 A G 9: 105,442,770 M468T possibly damaging Het
BC030499 T C 11: 78,291,623 L86P probably damaging Het
Brca1 A G 11: 101,508,146 I1540T probably benign Het
Cdh20 A T 1: 104,984,748 I576F probably damaging Het
Chst11 T A 10: 83,190,954 S72T probably damaging Het
Cldn17 T G 16: 88,506,645 K65N probably damaging Het
Cldn22 T C 8: 47,825,187 I220T probably benign Het
Colec10 T C 15: 54,462,371 V199A probably damaging Het
Cpn2 G T 16: 30,260,801 D27E probably damaging Het
F5 T A 1: 164,176,366 probably null Het
Fat3 C T 9: 16,031,360 V1239I possibly damaging Het
Fbxl16 A G 17: 25,816,906 N159S probably benign Het
Fhad1 A G 4: 141,954,187 I514T probably damaging Het
Fras1 A G 5: 96,781,584 K3949R probably damaging Het
Gm8126 A G 14: 43,261,566 N164S probably damaging Het
Grm3 T A 5: 9,589,880 E55V probably benign Het
Itgbl1 G A 14: 123,973,323 D478N possibly damaging Het
Kcnt2 T A 1: 140,354,509 Y77* probably null Het
Kdm4c T C 4: 74,404,821 S997P probably damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lrrc28 T C 7: 67,619,109 Y71C probably damaging Het
Lrrc45 T A 11: 120,715,880 W203R probably benign Het
Lrrc66 A T 5: 73,608,492 C403S possibly damaging Het
Ly6g6e A T 17: 35,077,918 E45V probably damaging Het
Mgam C T 6: 40,759,051 T1574I probably damaging Het
Msrb2 A T 2: 19,383,280 M80L probably benign Het
Musk T A 4: 58,367,513 L592Q probably damaging Het
Nlrp4a C A 7: 26,450,586 N539K probably benign Het
Obscn C G 11: 59,112,555 E1306Q probably benign Het
Olfr1006 T C 2: 85,674,563 E196G Het
Olfr1291-ps1 A G 2: 111,499,821 S190G probably damaging Het
Olfr355 A G 2: 36,927,359 F252L possibly damaging Het
Olfr388-ps1 A G 11: 73,724,536 S163P unknown Het
Opalin T A 19: 41,063,803 *144C probably null Het
Pdgfra T A 5: 75,192,418 probably benign Het
Pgam2 T A 11: 5,803,007 H196L possibly damaging Het
Pgls T C 8: 71,592,352 S46P probably damaging Het
Prrc2b A G 2: 32,204,115 E503G probably damaging Het
Prss45 T C 9: 110,841,035 L304P unknown Het
Rbm20 T A 19: 53,813,322 V87D probably damaging Het
Serpinb8 T C 1: 107,598,985 L85S probably benign Het
Sf3a2 ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT 10: 80,804,437 probably benign Het
Sh2b2 A T 5: 136,224,261 H352Q probably benign Het
Slc6a17 T C 3: 107,495,740 I124V probably damaging Het
Smim10l1 G A 6: 133,105,582 V31M probably damaging Het
Snx10 T C 6: 51,580,321 S78P probably benign Het
Stard10 T C 7: 101,342,631 V187A probably damaging Het
Svil C A 18: 5,118,357 D2146E probably benign Het
Tsc22d4 A G 5: 137,751,365 D301G probably null Het
Ube3c T A 5: 29,646,431 I752N probably damaging Het
Wisp2 G C 2: 163,829,041 R156T possibly damaging Het
Wwc1 T C 11: 35,844,163 M962V probably benign Het
Other mutations in Coasy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02364:Coasy APN 11 101084358 missense possibly damaging 0.76
IGL02633:Coasy APN 11 101085321 missense probably damaging 1.00
BB002:Coasy UTSW 11 101083696 missense probably benign
BB012:Coasy UTSW 11 101083696 missense probably benign
R0946:Coasy UTSW 11 101085870 missense probably damaging 0.96
R1434:Coasy UTSW 11 101084996 unclassified probably benign
R2269:Coasy UTSW 11 101085882 missense probably benign 0.01
R2881:Coasy UTSW 11 101085849 missense possibly damaging 0.90
R5037:Coasy UTSW 11 101084822 missense probably damaging 1.00
R5791:Coasy UTSW 11 101084385 splice site probably null
R6523:Coasy UTSW 11 101086118 missense probably damaging 1.00
R6696:Coasy UTSW 11 101083101 missense possibly damaging 0.68
R6931:Coasy UTSW 11 101083581 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACTATAAGGCCGGCTTCCC -3'
(R):5'- CAGAGTCCTTGGTTCCCATTTG -3'

Sequencing Primer
(F):5'- CCGGTTGCCAGATCTCCAAG -3'
(R):5'- TTCAGTTAAAAAGTGACTGAACCCC -3'
Posted On2020-08-07