Incidental Mutation 'R7925:Itgbl1'
ID643295
Institutional Source Beutler Lab
Gene Symbol Itgbl1
Ensembl Gene ENSMUSG00000032925
Gene Nameintegrin, beta-like 1
SynonymsB930011D01Rik, with EGF-like repeat domains
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R7925 (G1)
Quality Score999
Status Validated
Chromosome14
Chromosomal Location123659971-123975618 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 123973323 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 478 (D478N)
Ref Sequence ENSEMBL: ENSMUSP00000059019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026631] [ENSMUST00000049681] [ENSMUST00000095529] [ENSMUST00000132026] [ENSMUST00000142161]
Predicted Effect probably benign
Transcript: ENSMUST00000026631
SMART Domains Protein: ENSMUSP00000026631
Gene: ENSMUSG00000025551

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
FGF 69 200 1.75e-63 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000049681
AA Change: D478N

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000059019
Gene: ENSMUSG00000032925
AA Change: D478N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
internal_repeat_1 62 164 7.9e-12 PROSPERO
EGF_like 184 217 6.95e1 SMART
EGF 275 311 2.25e1 SMART
low complexity region 335 348 N/A INTRINSIC
Pfam:EGF_2 368 398 3.6e-8 PFAM
low complexity region 423 438 N/A INTRINSIC
low complexity region 448 456 N/A INTRINSIC
Blast:EGF_like 457 486 4e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000095529
SMART Domains Protein: ENSMUSP00000093185
Gene: ENSMUSG00000025551

DomainStartEndE-ValueType
FGF 74 205 1.75e-63 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000132026
AA Change: D354N

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115455
Gene: ENSMUSG00000032925
AA Change: D354N

DomainStartEndE-ValueType
internal_repeat_2 22 50 3.54e-8 PROSPERO
internal_repeat_1 23 87 7.45e-14 PROSPERO
low complexity region 101 126 N/A INTRINSIC
EGF 151 187 2.25e1 SMART
low complexity region 211 224 N/A INTRINSIC
Pfam:EGF_2 239 274 1.5e-7 PFAM
low complexity region 299 314 N/A INTRINSIC
low complexity region 324 332 N/A INTRINSIC
internal_repeat_2 334 362 3.54e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000142161
SMART Domains Protein: ENSMUSP00000121659
Gene: ENSMUSG00000032925

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
PDB:4G1E|B 59 171 1e-17 PDB
Blast:EGF_like 90 127 5e-15 BLAST
low complexity region 178 192 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a beta integrin-related protein that is a member of the EGF-like protein family. The encoded protein contains integrin-like cysteine-rich repeats. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,994,082 Q392* probably null Het
4933427D14Rik A C 11: 72,180,501 L473V probably benign Het
A930002H24Rik A T 17: 63,863,397 V132E unknown Het
Abcc2 A G 19: 43,807,112 I436V probably benign Het
Ahr G A 12: 35,515,068 Q103* probably null Het
Asb15 T A 6: 24,562,724 H228Q probably benign Het
Asphd1 T A 7: 126,948,456 Y225F probably damaging Het
Atp2c1 A G 9: 105,442,770 M468T possibly damaging Het
BC030499 T C 11: 78,291,623 L86P probably damaging Het
Brca1 A G 11: 101,508,146 I1540T probably benign Het
Cdh20 A T 1: 104,984,748 I576F probably damaging Het
Chst11 T A 10: 83,190,954 S72T probably damaging Het
Cldn17 T G 16: 88,506,645 K65N probably damaging Het
Cldn22 T C 8: 47,825,187 I220T probably benign Het
Coasy T G 11: 101,083,696 D229E probably benign Het
Colec10 T C 15: 54,462,371 V199A probably damaging Het
Cpn2 G T 16: 30,260,801 D27E probably damaging Het
F5 T A 1: 164,176,366 probably null Het
Fat3 C T 9: 16,031,360 V1239I possibly damaging Het
Fbxl16 A G 17: 25,816,906 N159S probably benign Het
Fhad1 A G 4: 141,954,187 I514T probably damaging Het
Fras1 A G 5: 96,781,584 K3949R probably damaging Het
Gm8126 A G 14: 43,261,566 N164S probably damaging Het
Grm3 T A 5: 9,589,880 E55V probably benign Het
Kcnt2 T A 1: 140,354,509 Y77* probably null Het
Kdm4c T C 4: 74,404,821 S997P probably damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lrrc28 T C 7: 67,619,109 Y71C probably damaging Het
Lrrc45 T A 11: 120,715,880 W203R probably benign Het
Lrrc66 A T 5: 73,608,492 C403S possibly damaging Het
Ly6g6e A T 17: 35,077,918 E45V probably damaging Het
Mgam C T 6: 40,759,051 T1574I probably damaging Het
Msrb2 A T 2: 19,383,280 M80L probably benign Het
Musk T A 4: 58,367,513 L592Q probably damaging Het
Nlrp4a C A 7: 26,450,586 N539K probably benign Het
Obscn C G 11: 59,112,555 E1306Q probably benign Het
Olfr1006 T C 2: 85,674,563 E196G Het
Olfr1291-ps1 A G 2: 111,499,821 S190G probably damaging Het
Olfr355 A G 2: 36,927,359 F252L possibly damaging Het
Olfr388-ps1 A G 11: 73,724,536 S163P unknown Het
Opalin T A 19: 41,063,803 *144C probably null Het
Pdgfra T A 5: 75,192,418 probably benign Het
Pgam2 T A 11: 5,803,007 H196L possibly damaging Het
Pgls T C 8: 71,592,352 S46P probably damaging Het
Prrc2b A G 2: 32,204,115 E503G probably damaging Het
Prss45 T C 9: 110,841,035 L304P unknown Het
Rbm20 T A 19: 53,813,322 V87D probably damaging Het
Serpinb8 T C 1: 107,598,985 L85S probably benign Het
Sf3a2 ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT 10: 80,804,437 probably benign Het
Sh2b2 A T 5: 136,224,261 H352Q probably benign Het
Slc6a17 T C 3: 107,495,740 I124V probably damaging Het
Smim10l1 G A 6: 133,105,582 V31M probably damaging Het
Snx10 T C 6: 51,580,321 S78P probably benign Het
Stard10 T C 7: 101,342,631 V187A probably damaging Het
Svil C A 18: 5,118,357 D2146E probably benign Het
Tsc22d4 A G 5: 137,751,365 D301G probably null Het
Ube3c T A 5: 29,646,431 I752N probably damaging Het
Wisp2 G C 2: 163,829,041 R156T possibly damaging Het
Wwc1 T C 11: 35,844,163 M962V probably benign Het
Other mutations in Itgbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Itgbl1 APN 14 123846432 splice site probably benign
IGL01290:Itgbl1 APN 14 123966725 missense probably benign 0.02
IGL01618:Itgbl1 APN 14 123827799 missense possibly damaging 0.88
IGL02024:Itgbl1 APN 14 123857492 missense probably damaging 1.00
IGL02192:Itgbl1 APN 14 123843926 missense probably damaging 1.00
IGL02215:Itgbl1 APN 14 123972141 missense probably benign 0.01
IGL02400:Itgbl1 APN 14 123846526 missense probably damaging 1.00
IGL02483:Itgbl1 APN 14 123827743 splice site probably benign
BB002:Itgbl1 UTSW 14 123973323 missense possibly damaging 0.68
BB012:Itgbl1 UTSW 14 123973323 missense possibly damaging 0.68
H8441:Itgbl1 UTSW 14 123973287 missense probably damaging 1.00
R0137:Itgbl1 UTSW 14 123840686 critical splice donor site probably null
R0193:Itgbl1 UTSW 14 123846546 missense probably benign 0.09
R0355:Itgbl1 UTSW 14 123840585 nonsense probably null
R0598:Itgbl1 UTSW 14 123857436 missense possibly damaging 0.93
R0662:Itgbl1 UTSW 14 123827894 missense probably damaging 1.00
R0689:Itgbl1 UTSW 14 123827847 missense possibly damaging 0.65
R1385:Itgbl1 UTSW 14 123661511 splice site probably null
R1957:Itgbl1 UTSW 14 123966678 missense probably damaging 1.00
R3739:Itgbl1 UTSW 14 123966678 missense probably damaging 1.00
R3842:Itgbl1 UTSW 14 123840565 missense possibly damaging 0.92
R4434:Itgbl1 UTSW 14 123972199 missense probably damaging 1.00
R4463:Itgbl1 UTSW 14 123840668 missense probably damaging 0.97
R4696:Itgbl1 UTSW 14 123966708 missense probably damaging 1.00
R4937:Itgbl1 UTSW 14 123973368 missense probably benign 0.12
R5087:Itgbl1 UTSW 14 123966739 missense possibly damaging 0.52
R5747:Itgbl1 UTSW 14 123972164 nonsense probably null
R6020:Itgbl1 UTSW 14 123846565 missense probably damaging 0.99
R6169:Itgbl1 UTSW 14 123660378 missense probably benign 0.17
R6758:Itgbl1 UTSW 14 123857489 missense probably benign 0.23
R7213:Itgbl1 UTSW 14 123973297 missense probably damaging 1.00
R7259:Itgbl1 UTSW 14 123843904 missense probably damaging 0.96
R7378:Itgbl1 UTSW 14 123857489 missense probably benign 0.23
R7461:Itgbl1 UTSW 14 123827799 missense possibly damaging 0.88
R7664:Itgbl1 UTSW 14 123846550 missense probably damaging 1.00
R7841:Itgbl1 UTSW 14 123972233 critical splice donor site probably null
R8115:Itgbl1 UTSW 14 123857543 missense probably damaging 1.00
R8260:Itgbl1 UTSW 14 123827834 missense probably benign 0.00
R8778:Itgbl1 UTSW 14 123840663 missense probably benign 0.01
R8978:Itgbl1 UTSW 14 123972205 missense probably damaging 1.00
V1024:Itgbl1 UTSW 14 123973287 missense probably damaging 1.00
X0012:Itgbl1 UTSW 14 123661305 missense probably benign 0.01
X0017:Itgbl1 UTSW 14 123972211 missense possibly damaging 0.81
Z1176:Itgbl1 UTSW 14 123954672 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGTGATGAAAGGTAGGTACTGTTC -3'
(R):5'- CCAGTTGGGCAGTCAGAAATAG -3'

Sequencing Primer
(F):5'- GGGAGGATAAATGGTTTCCT -3'
(R):5'- GAGAAACACACAAAAGTCTGTCCTAG -3'
Posted On2020-08-07