Incidental Mutation 'R7925:Rbm20'
ID 643305
Institutional Source Beutler Lab
Gene Symbol Rbm20
Ensembl Gene ENSMUSG00000043639
Gene Name RNA binding motif protein 20
Synonyms 2010003H22Rik, 1110018J23Rik
MMRRC Submission 045972-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.115) question?
Stock # R7925 (G1)
Quality Score 999
Status Validated
Chromosome 19
Chromosomal Location 53665737-53855511 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 53801753 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 87 (V87D)
Ref Sequence ENSEMBL: ENSMUSP00000093665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095969] [ENSMUST00000164202]
AlphaFold Q3UQS8
Predicted Effect probably damaging
Transcript: ENSMUST00000095969
AA Change: V87D

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093665
Gene: ENSMUSG00000043639
AA Change: V87D

DomainStartEndE-ValueType
low complexity region 25 61 N/A INTRINSIC
low complexity region 106 117 N/A INTRINSIC
low complexity region 170 183 N/A INTRINSIC
low complexity region 251 260 N/A INTRINSIC
ZnF_C2H2 413 437 4.69e0 SMART
RRM 521 591 4.01e-5 SMART
low complexity region 634 657 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164202
AA Change: V87D

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129447
Gene: ENSMUSG00000043639
AA Change: V87D

DomainStartEndE-ValueType
low complexity region 25 61 N/A INTRINSIC
low complexity region 106 117 N/A INTRINSIC
low complexity region 170 183 N/A INTRINSIC
low complexity region 251 260 N/A INTRINSIC
ZnF_U1 410 444 6.79e-1 SMART
ZnF_C2H2 413 437 4.69e0 SMART
RRM 521 591 4.01e-5 SMART
low complexity region 634 657 N/A INTRINSIC
low complexity region 804 815 N/A INTRINSIC
low complexity region 833 844 N/A INTRINSIC
ZnF_U1 1130 1165 7.26e-6 SMART
ZnF_C2H2 1133 1158 3.13e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds RNA and regulates splicing. Mutations in this gene have been associated with familial dilated cardiomyopathy. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for an allele lacking the RNA recognition motif exhibit increased titin compliance, and attenuated Frank-Starling mechanism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,643,506 (GRCm39) Q392* probably null Het
4933427D14Rik A C 11: 72,071,327 (GRCm39) L473V probably benign Het
A930002H24Rik A T 17: 64,170,392 (GRCm39) V132E unknown Het
Abcc2 A G 19: 43,795,551 (GRCm39) I436V probably benign Het
Ahr G A 12: 35,565,067 (GRCm39) Q103* probably null Het
Asb15 T A 6: 24,562,723 (GRCm39) H228Q probably benign Het
Asphd1 T A 7: 126,547,628 (GRCm39) Y225F probably damaging Het
Atp2c1 A G 9: 105,319,969 (GRCm39) M468T possibly damaging Het
Brca1 A G 11: 101,398,972 (GRCm39) I1540T probably benign Het
Ccn5 G C 2: 163,670,961 (GRCm39) R156T possibly damaging Het
Cdh20 A T 1: 104,912,473 (GRCm39) I576F probably damaging Het
Chst11 T A 10: 83,026,788 (GRCm39) S72T probably damaging Het
Cldn17 T G 16: 88,303,533 (GRCm39) K65N probably damaging Het
Cldn22 T C 8: 48,278,222 (GRCm39) I220T probably benign Het
Coasy T G 11: 100,974,522 (GRCm39) D229E probably benign Het
Colec10 T C 15: 54,325,767 (GRCm39) V199A probably damaging Het
Cpn2 G T 16: 30,079,619 (GRCm39) D27E probably damaging Het
F5 T A 1: 164,003,935 (GRCm39) probably null Het
Fat3 C T 9: 15,942,656 (GRCm39) V1239I possibly damaging Het
Fbxl16 A G 17: 26,035,880 (GRCm39) N159S probably benign Het
Fhad1 A G 4: 141,681,498 (GRCm39) I514T probably damaging Het
Fras1 A G 5: 96,929,443 (GRCm39) K3949R probably damaging Het
Gm8126 A G 14: 43,119,023 (GRCm39) N164S probably damaging Het
Grm3 T A 5: 9,639,880 (GRCm39) E55V probably benign Het
Itgbl1 G A 14: 124,210,735 (GRCm39) D478N possibly damaging Het
Kcnt2 T A 1: 140,282,247 (GRCm39) Y77* probably null Het
Kdm4c T C 4: 74,323,058 (GRCm39) S997P probably damaging Het
Kti12 A C 4: 108,705,443 (GRCm39) E119A probably benign Het
Kti12 G T 4: 108,705,444 (GRCm39) E119D probably benign Het
Lrrc28 T C 7: 67,268,857 (GRCm39) Y71C probably damaging Het
Lrrc45 T A 11: 120,606,706 (GRCm39) W203R probably benign Het
Lrrc66 A T 5: 73,765,835 (GRCm39) C403S possibly damaging Het
Ly6g6e A T 17: 35,296,894 (GRCm39) E45V probably damaging Het
Mgam C T 6: 40,735,985 (GRCm39) T1574I probably damaging Het
Msrb2 A T 2: 19,388,091 (GRCm39) M80L probably benign Het
Musk T A 4: 58,367,513 (GRCm39) L592Q probably damaging Het
Nlrp4a C A 7: 26,150,011 (GRCm39) N539K probably benign Het
Obscn C G 11: 59,003,381 (GRCm39) E1306Q probably benign Het
Opalin T A 19: 41,052,242 (GRCm39) *144C probably null Het
Or1e28-ps1 A G 11: 73,615,362 (GRCm39) S163P unknown Het
Or1l8 A G 2: 36,817,371 (GRCm39) F252L possibly damaging Het
Or4f4-ps1 A G 2: 111,330,166 (GRCm39) S190G probably damaging Het
Or9g4 T C 2: 85,504,907 (GRCm39) E196G Het
Pdgfra T A 5: 75,353,079 (GRCm39) probably benign Het
Pgam2 T A 11: 5,753,007 (GRCm39) H196L possibly damaging Het
Pgls T C 8: 72,044,996 (GRCm39) S46P probably damaging Het
Prrc2b A G 2: 32,094,127 (GRCm39) E503G probably damaging Het
Prss45 T C 9: 110,670,103 (GRCm39) L304P unknown Het
Rskr T C 11: 78,182,449 (GRCm39) L86P probably damaging Het
Serpinb8 T C 1: 107,526,715 (GRCm39) L85S probably benign Het
Sf3a2 ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT 10: 80,640,271 (GRCm39) probably benign Het
Sh2b2 A T 5: 136,253,115 (GRCm39) H352Q probably benign Het
Slc6a17 T C 3: 107,403,056 (GRCm39) I124V probably damaging Het
Smim10l1 G A 6: 133,082,545 (GRCm39) V31M probably damaging Het
Snx10 T C 6: 51,557,301 (GRCm39) S78P probably benign Het
Stard10 T C 7: 100,991,838 (GRCm39) V187A probably damaging Het
Svil C A 18: 5,118,357 (GRCm39) D2146E probably benign Het
Tsc22d4 A G 5: 137,749,627 (GRCm39) D301G probably null Het
Ube3c T A 5: 29,851,429 (GRCm39) I752N probably damaging Het
Wwc1 T C 11: 35,734,990 (GRCm39) M962V probably benign Het
Other mutations in Rbm20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Rbm20 APN 19 53,831,695 (GRCm39) missense probably damaging 1.00
IGL00815:Rbm20 APN 19 53,803,948 (GRCm39) missense probably damaging 1.00
IGL00845:Rbm20 APN 19 53,806,380 (GRCm39) missense probably damaging 1.00
IGL01408:Rbm20 APN 19 53,840,044 (GRCm39) missense possibly damaging 0.95
IGL01663:Rbm20 APN 19 53,829,426 (GRCm39) missense probably damaging 1.00
IGL01902:Rbm20 APN 19 53,829,422 (GRCm39) missense probably damaging 0.99
IGL01942:Rbm20 APN 19 53,801,874 (GRCm39) missense probably damaging 1.00
IGL02964:Rbm20 APN 19 53,802,133 (GRCm39) missense probably benign 0.02
IGL03326:Rbm20 APN 19 53,802,431 (GRCm39) missense possibly damaging 0.85
BB001:Rbm20 UTSW 19 53,666,016 (GRCm39) missense possibly damaging 0.63
BB002:Rbm20 UTSW 19 53,801,753 (GRCm39) missense probably damaging 0.97
BB011:Rbm20 UTSW 19 53,666,016 (GRCm39) missense possibly damaging 0.63
BB012:Rbm20 UTSW 19 53,801,753 (GRCm39) missense probably damaging 0.97
R0326:Rbm20 UTSW 19 53,852,596 (GRCm39) missense probably damaging 1.00
R0487:Rbm20 UTSW 19 53,839,626 (GRCm39) missense probably damaging 1.00
R0965:Rbm20 UTSW 19 53,847,832 (GRCm39) missense probably damaging 1.00
R1435:Rbm20 UTSW 19 53,802,588 (GRCm39) missense probably benign 0.16
R1914:Rbm20 UTSW 19 53,852,518 (GRCm39) missense probably damaging 1.00
R1915:Rbm20 UTSW 19 53,852,518 (GRCm39) missense probably damaging 1.00
R2011:Rbm20 UTSW 19 53,847,859 (GRCm39) missense probably damaging 1.00
R2012:Rbm20 UTSW 19 53,847,859 (GRCm39) missense probably damaging 1.00
R2258:Rbm20 UTSW 19 53,840,172 (GRCm39) missense probably benign
R3947:Rbm20 UTSW 19 53,801,768 (GRCm39) missense probably benign 0.35
R4305:Rbm20 UTSW 19 53,831,691 (GRCm39) missense probably damaging 1.00
R4308:Rbm20 UTSW 19 53,831,691 (GRCm39) missense probably damaging 1.00
R4521:Rbm20 UTSW 19 53,805,633 (GRCm39) missense probably benign 0.14
R4970:Rbm20 UTSW 19 53,840,100 (GRCm39) missense probably damaging 0.99
R5266:Rbm20 UTSW 19 53,801,818 (GRCm39) missense probably damaging 1.00
R5475:Rbm20 UTSW 19 53,823,136 (GRCm39) nonsense probably null
R5503:Rbm20 UTSW 19 53,839,785 (GRCm39) missense possibly damaging 0.75
R5995:Rbm20 UTSW 19 53,839,698 (GRCm39) missense possibly damaging 0.95
R6836:Rbm20 UTSW 19 53,802,500 (GRCm39) missense probably damaging 0.98
R6947:Rbm20 UTSW 19 53,839,696 (GRCm39) missense probably damaging 1.00
R7030:Rbm20 UTSW 19 53,823,197 (GRCm39) missense probably damaging 1.00
R7117:Rbm20 UTSW 19 53,839,989 (GRCm39) missense possibly damaging 0.92
R7237:Rbm20 UTSW 19 53,839,930 (GRCm39) missense probably benign 0.04
R7638:Rbm20 UTSW 19 53,802,764 (GRCm39) missense possibly damaging 0.95
R7792:Rbm20 UTSW 19 53,838,567 (GRCm39) missense probably benign
R7823:Rbm20 UTSW 19 53,831,785 (GRCm39) missense probably benign 0.33
R7924:Rbm20 UTSW 19 53,666,016 (GRCm39) missense possibly damaging 0.63
R8044:Rbm20 UTSW 19 53,806,402 (GRCm39) missense probably benign 0.44
R8045:Rbm20 UTSW 19 53,806,402 (GRCm39) missense probably benign 0.44
R8046:Rbm20 UTSW 19 53,806,402 (GRCm39) missense probably benign 0.44
R8100:Rbm20 UTSW 19 53,839,744 (GRCm39) missense possibly damaging 0.85
R8292:Rbm20 UTSW 19 53,839,930 (GRCm39) missense possibly damaging 0.71
R8366:Rbm20 UTSW 19 53,838,612 (GRCm39) missense possibly damaging 0.95
R8518:Rbm20 UTSW 19 53,839,923 (GRCm39) missense probably benign 0.18
R8799:Rbm20 UTSW 19 53,821,120 (GRCm39) missense probably damaging 1.00
R8873:Rbm20 UTSW 19 53,665,911 (GRCm39) missense probably benign 0.00
R8886:Rbm20 UTSW 19 53,801,767 (GRCm39) missense probably benign 0.00
R9194:Rbm20 UTSW 19 53,823,131 (GRCm39) missense probably damaging 1.00
R9226:Rbm20 UTSW 19 53,839,645 (GRCm39) missense possibly damaging 0.92
R9765:Rbm20 UTSW 19 53,840,060 (GRCm39) missense probably benign
R9793:Rbm20 UTSW 19 53,852,551 (GRCm39) missense probably benign 0.03
R9795:Rbm20 UTSW 19 53,852,551 (GRCm39) missense probably benign 0.03
RF016:Rbm20 UTSW 19 53,802,163 (GRCm39) missense probably benign 0.00
Z1177:Rbm20 UTSW 19 53,840,116 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGACCTATGAGGCAGGGTC -3'
(R):5'- CGAAAAGGCGATTGCGGTTG -3'

Sequencing Primer
(F):5'- CCTATGAGGCAGGGTCTTGTTGAC -3'
(R):5'- AACCGAGGCAGCATGCTG -3'
Posted On 2020-08-07