Incidental Mutation 'R0053:Usp19'
ID64331
Institutional Source Beutler Lab
Gene Symbol Usp19
Ensembl Gene ENSMUSG00000006676
Gene Nameubiquitin specific peptidase 19
Synonyms8430421I07Rik
MMRRC Submission 038347-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R0053 (G1)
Quality Score118
Status Validated
Chromosome9
Chromosomal Location108490602-108502337 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 108497170 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000006854] [ENSMUST00000085044] [ENSMUST00000166103] [ENSMUST00000178075] [ENSMUST00000193678]
Predicted Effect probably null
Transcript: ENSMUST00000006854
SMART Domains Protein: ENSMUSP00000006854
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 1.3e-6 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 414 7.1e-19 PFAM
Pfam:USP19_linker 415 537 2.2e-61 PFAM
Pfam:UCH 538 1253 1.2e-77 PFAM
Pfam:UCH_1 539 874 8.6e-11 PFAM
Pfam:zf-MYND 833 875 9.9e-11 PFAM
Pfam:UCH_1 1021 1235 7.1e-10 PFAM
low complexity region 1278 1287 N/A INTRINSIC
low complexity region 1301 1312 N/A INTRINSIC
transmembrane domain 1333 1355 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000085044
SMART Domains Protein: ENSMUSP00000082119
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 4.7e-7 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 414 2.5e-15 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 524 530 N/A INTRINSIC
Pfam:UCH 538 1253 7.4e-84 PFAM
Pfam:UCH_1 539 879 2.3e-13 PFAM
Pfam:zf-MYND 833 875 2.4e-10 PFAM
Pfam:UCH_1 1020 1235 2.9e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166103
SMART Domains Protein: ENSMUSP00000128573
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 2.6e-7 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 390 3.9e-9 PFAM
low complexity region 425 436 N/A INTRINSIC
low complexity region 500 506 N/A INTRINSIC
Pfam:UCH 514 1229 1.8e-84 PFAM
Pfam:UCH_1 515 855 5.5e-14 PFAM
Pfam:zf-MYND 809 851 1.7e-10 PFAM
Pfam:UCH_1 996 1211 6.9e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000178075
SMART Domains Protein: ENSMUSP00000135930
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 1e-6 PFAM
low complexity region 258 269 N/A INTRINSIC
Pfam:CS 327 415 5.4e-15 PFAM
low complexity region 450 461 N/A INTRINSIC
low complexity region 525 531 N/A INTRINSIC
Pfam:UCH 539 1254 4.9e-84 PFAM
Pfam:UCH_1 540 880 1.4e-13 PFAM
Pfam:zf-MYND 834 876 5.2e-10 PFAM
Pfam:UCH_1 1021 1236 1.8e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193412
Predicted Effect probably benign
Transcript: ENSMUST00000193558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193571
Predicted Effect probably null
Transcript: ENSMUST00000193678
SMART Domains Protein: ENSMUSP00000141738
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 6.8e-7 PFAM
low complexity region 258 269 N/A INTRINSIC
Pfam:CS 327 415 3.6e-15 PFAM
low complexity region 448 459 N/A INTRINSIC
low complexity region 523 529 N/A INTRINSIC
Pfam:UCH 537 1252 3.8e-84 PFAM
Pfam:UCH_1 538 878 1.1e-13 PFAM
Pfam:zf-MYND 832 874 5.1e-10 PFAM
Pfam:UCH_1 1019 1234 1.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193975
Predicted Effect probably null
Transcript: ENSMUST00000194171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194225
Predicted Effect probably null
Transcript: ENSMUST00000194863
Predicted Effect probably null
Transcript: ENSMUST00000194863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194499
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.5%
Validation Efficiency 100% (67/67)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased body weight, reduced male fertility, and increased resistance to skeletal muscle atrophy induced by both glucocorticoids and denervation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,327,590 D711E probably benign Het
5730559C18Rik C T 1: 136,227,550 V106I probably benign Het
Ada A T 2: 163,732,292 V148D probably damaging Het
Alpi T C 1: 87,098,790 D493G probably benign Het
Atp10b A G 11: 43,216,564 probably benign Het
AY761185 A T 8: 20,944,530 probably benign Het
BC067074 T C 13: 113,368,489 W2051R probably benign Het
Cadm1 C T 9: 47,799,414 T205I probably damaging Het
Capn3 A G 2: 120,491,837 I413V possibly damaging Het
Cblb C T 16: 52,142,801 T369I probably damaging Het
Ccdc54 T A 16: 50,590,234 N223I probably benign Het
Cdc25c A G 18: 34,735,435 V294A probably benign Het
Cep170 A T 1: 176,782,380 S122T possibly damaging Het
Chd1 A G 17: 15,747,189 N849D probably damaging Het
Dpp3 A G 19: 4,923,126 C147R probably damaging Het
Dst A G 1: 34,294,550 probably null Het
Fbxw9 T A 8: 85,064,454 L250Q probably damaging Het
Gpr75 A T 11: 30,892,571 Q492L possibly damaging Het
Gramd4 T A 15: 86,130,138 probably benign Het
Hivep2 T C 10: 14,132,121 C1488R probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Insr A G 8: 3,155,683 S1369P probably damaging Het
Insrr A C 3: 87,800,452 D67A probably damaging Het
Irf2 T A 8: 46,818,851 Y158N probably benign Het
Katnbl1 A G 2: 112,404,241 R23G probably benign Het
Lamb2 T A 9: 108,486,737 C987* probably null Het
Lzts2 T C 19: 45,026,307 probably benign Het
Mmp14 T A 14: 54,438,652 probably benign Het
Mycbpap A G 11: 94,511,736 Y258H probably damaging Het
Nav3 A G 10: 109,766,917 probably benign Het
Olfr1186 T A 2: 88,526,163 N193K probably damaging Het
Olfr1406 T C 1: 173,184,278 D52G probably benign Het
Parp10 T A 15: 76,242,246 L247F probably damaging Het
Pcsk6 C T 7: 65,983,703 probably benign Het
Pgap3 A T 11: 98,391,098 V129D probably damaging Het
Pibf1 A G 14: 99,140,557 Y373C probably damaging Het
Plcb1 A G 2: 135,294,915 E310G probably benign Het
Plin3 T C 17: 56,279,892 D385G probably damaging Het
Pole A T 5: 110,293,340 D220V probably damaging Het
Ptprk T A 10: 28,475,109 F533I probably damaging Het
Rufy1 A T 11: 50,401,465 M499K probably benign Het
Scn1a T G 2: 66,299,775 D1232A probably benign Het
Sec23ip T C 7: 128,745,167 L49P probably damaging Het
Sf3b1 G A 1: 55,000,373 Q698* probably null Het
Shprh A T 10: 11,194,372 probably null Het
Snd1 C A 6: 28,745,335 probably benign Het
Stab1 C T 14: 31,140,687 A2260T possibly damaging Het
Stpg2 A G 3: 139,212,321 Q60R probably benign Het
Strn T C 17: 78,656,934 H687R possibly damaging Het
Tgfb3 A T 12: 86,077,829 I35N probably damaging Het
Tnks2 T C 19: 36,875,365 S166P probably damaging Het
Tyw5 G A 1: 57,401,438 T55M probably damaging Het
Zfp13 A T 17: 23,576,148 I483N probably damaging Het
Other mutations in Usp19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Usp19 APN 9 108498961 missense possibly damaging 0.79
IGL02345:Usp19 APN 9 108493858 missense probably benign
IGL03026:Usp19 APN 9 108493145 missense probably damaging 1.00
IGL03057:Usp19 APN 9 108499130 missense probably benign 0.01
IGL03073:Usp19 APN 9 108495803 unclassified probably benign
IGL03333:Usp19 APN 9 108494149 missense probably benign 0.05
PIT4504001:Usp19 UTSW 9 108492970 missense probably benign 0.00
PIT4576001:Usp19 UTSW 9 108492732 critical splice donor site probably null
R0053:Usp19 UTSW 9 108497170 splice site probably null
R0138:Usp19 UTSW 9 108501315 missense possibly damaging 0.86
R0281:Usp19 UTSW 9 108498509 missense probably damaging 1.00
R0386:Usp19 UTSW 9 108499711 missense probably damaging 1.00
R0454:Usp19 UTSW 9 108494240 critical splice donor site probably null
R0506:Usp19 UTSW 9 108494487 missense probably damaging 1.00
R0542:Usp19 UTSW 9 108494385 splice site probably null
R0800:Usp19 UTSW 9 108495154 missense probably damaging 0.97
R0829:Usp19 UTSW 9 108493801 missense probably benign
R1594:Usp19 UTSW 9 108498522 missense probably damaging 1.00
R1917:Usp19 UTSW 9 108499325 nonsense probably null
R3744:Usp19 UTSW 9 108500181 missense probably damaging 1.00
R3964:Usp19 UTSW 9 108498029 missense probably damaging 1.00
R4275:Usp19 UTSW 9 108498694 missense probably damaging 1.00
R4789:Usp19 UTSW 9 108493234 missense possibly damaging 0.75
R5247:Usp19 UTSW 9 108496065 splice site probably null
R5249:Usp19 UTSW 9 108492608 start codon destroyed probably null 0.85
R5400:Usp19 UTSW 9 108500193 missense probably damaging 1.00
R5445:Usp19 UTSW 9 108497920 missense possibly damaging 0.61
R5578:Usp19 UTSW 9 108493440 missense probably benign
R5934:Usp19 UTSW 9 108492567 unclassified probably benign
R6003:Usp19 UTSW 9 108496380 missense probably damaging 1.00
R6217:Usp19 UTSW 9 108500144 missense probably damaging 1.00
R6230:Usp19 UTSW 9 108501941 missense probably damaging 0.99
R6505:Usp19 UTSW 9 108496883 missense probably damaging 1.00
R6585:Usp19 UTSW 9 108499727 missense probably damaging 0.97
R6865:Usp19 UTSW 9 108498819 nonsense probably null
R6953:Usp19 UTSW 9 108498931 missense possibly damaging 0.90
R7037:Usp19 UTSW 9 108496958 missense possibly damaging 0.52
R7046:Usp19 UTSW 9 108497135 missense possibly damaging 0.48
R7235:Usp19 UTSW 9 108494924 nonsense probably null
R7699:Usp19 UTSW 9 108496172 nonsense probably null
R7705:Usp19 UTSW 9 108501913 missense possibly damaging 0.89
R8175:Usp19 UTSW 9 108500178 missense probably damaging 1.00
RF041:Usp19 UTSW 9 108493988 critical splice acceptor site unknown
Predicted Primers PCR Primer
(F):5'- CAAGCCCATCAAGGTGAGTAACCAG -3'
(R):5'- TCACTGACCCTCCATAAGGAACGG -3'

Sequencing Primer
(F):5'- GTGAGTAACCAGCCCCCTTC -3'
(R):5'- tgggaggcagaggcagg -3'
Posted On2013-08-06