Incidental Mutation 'R7926:Kti12'
ID643319
Institutional Source Beutler Lab
Gene Symbol Kti12
Ensembl Gene ENSMUSG00000073775
Gene NameKTI12 homolog, chromatin associated
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7926 (G1)
Quality Score351.242
Status Not validated
Chromosome4
Chromosomal Location108847785-108849413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 108848247 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 119 (E119D)
Ref Sequence ENSEMBL: ENSMUSP00000099799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030296] [ENSMUST00000102738] [ENSMUST00000164855]
Predicted Effect probably benign
Transcript: ENSMUST00000030296
SMART Domains Protein: ENSMUSP00000030296
Gene: ENSMUSG00000028567

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
Pfam:Thioredoxin_7 37 118 1.1e-19 PFAM
Pfam:Thioredoxin 41 135 1.9e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102738
AA Change: E119D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099799
Gene: ENSMUSG00000073775
AA Change: E119D

DomainStartEndE-ValueType
Pfam:KTI12 1 347 3.3e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164855
SMART Domains Protein: ENSMUSP00000128780
Gene: ENSMUSG00000090551

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
low complexity region 47 64 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
BC016579 C A 16: 45,629,462 D198Y probably damaging Het
Cep170 A G 1: 176,761,413 S549P probably damaging Het
Cnih3 T C 1: 181,450,001 L96P probably damaging Het
Cnn2 T A 10: 79,993,326 L168Q probably damaging Het
Cnot1 ACG A 8: 95,745,647 probably null Het
Cnot10 A G 9: 114,617,815 C398R probably damaging Het
Dcaf4 C A 12: 83,533,929 Y212* probably null Het
Dmxl2 T C 9: 54,428,042 T665A probably benign Het
Dnmt1 C A 9: 20,907,559 A1609S unknown Het
Dzip1 T C 14: 118,883,499 D682G probably benign Het
Fam76a A G 4: 132,902,094 L249P probably damaging Het
Fgf10 T C 13: 118,789,216 M177T probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gm340 T C 19: 41,582,569 F67S probably benign Het
Hoxa13 CG CGAG 6: 52,260,636 probably null Het
Itln1 G A 1: 171,531,693 T73I probably benign Het
Jkamp T C 12: 72,094,816 Y197H probably damaging Het
Lmf2 G A 15: 89,352,421 P514L probably damaging Het
Lmntd2 G T 7: 141,210,345 P610Q probably damaging Het
Map3k3 T C 11: 106,145,722 S225P probably damaging Het
Mbd5 T C 2: 49,256,323 Y182H probably damaging Het
Mki67 A G 7: 135,697,140 V2055A possibly damaging Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Myh8 C T 11: 67,278,906 P17L possibly damaging Het
Myt1l T A 12: 29,811,652 D144E unknown Het
Nfatc1 T C 18: 80,697,666 Y373C probably damaging Het
Pacs2 C T 12: 113,060,752 L418F probably damaging Het
Paxip1 A G 5: 27,791,209 I24T unknown Het
Pdcl C T 2: 37,352,237 G167E probably damaging Het
Pdcl A C 2: 37,352,239 S166R probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Qsox1 C T 1: 155,812,787 G5S unknown Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Sass6 T A 3: 116,628,770 S641T possibly damaging Het
Six1 T C 12: 73,043,809 N194S probably benign Het
Tagap T C 17: 7,926,938 probably null Het
Tiparp T C 3: 65,553,525 V645A possibly damaging Het
Tm2d2 T C 8: 25,020,464 V113A probably damaging Het
Tmprss6 C A 15: 78,452,850 R352L probably benign Het
Tslp A G 18: 32,817,193 E105G possibly damaging Het
Ttc41 A G 10: 86,776,047 E1093G probably benign Het
Ush2a G A 1: 188,728,600 R2686H probably benign Het
Usp54 A T 14: 20,576,968 Y541N probably damaging Het
Vmn2r125 A G 4: 156,350,693 D122G probably damaging Het
Other mutations in Kti12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02608:Kti12 APN 4 108848162 missense probably damaging 1.00
IGL02891:Kti12 APN 4 108848533 missense probably benign
IGL03142:Kti12 APN 4 108848165 missense probably damaging 1.00
BB002:Kti12 UTSW 4 108848246 missense probably benign
BB002:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB003:Kti12 UTSW 4 108848246 missense probably benign
BB003:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB004:Kti12 UTSW 4 108848246 missense probably benign
BB004:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB006:Kti12 UTSW 4 108848246 missense probably benign
BB006:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB012:Kti12 UTSW 4 108848246 missense probably benign
BB012:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB013:Kti12 UTSW 4 108848246 missense probably benign
BB013:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB014:Kti12 UTSW 4 108848246 missense probably benign
BB014:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB016:Kti12 UTSW 4 108848246 missense probably benign
BB016:Kti12 UTSW 4 108848247 missense probably benign 0.00
R0518:Kti12 UTSW 4 108848579 missense possibly damaging 0.95
R1681:Kti12 UTSW 4 108848858 missense probably damaging 1.00
R5510:Kti12 UTSW 4 108848624 missense probably damaging 1.00
R5522:Kti12 UTSW 4 108848423 missense possibly damaging 0.58
R6652:Kti12 UTSW 4 108848533 missense probably benign 0.00
R6774:Kti12 UTSW 4 108848455 missense probably benign 0.12
R7123:Kti12 UTSW 4 108848482 missense probably benign 0.00
R7856:Kti12 UTSW 4 108848246 missense probably benign
R7856:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7858:Kti12 UTSW 4 108848246 missense probably benign
R7858:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7859:Kti12 UTSW 4 108848246 missense probably benign
R7859:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7914:Kti12 UTSW 4 108848246 missense probably benign
R7914:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7915:Kti12 UTSW 4 108848246 missense probably benign
R7915:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7916:Kti12 UTSW 4 108848246 missense probably benign
R7916:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7917:Kti12 UTSW 4 108848246 missense probably benign
R7917:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7918:Kti12 UTSW 4 108848246 missense probably benign
R7918:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7925:Kti12 UTSW 4 108848246 missense probably benign
R7925:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7926:Kti12 UTSW 4 108848246 missense probably benign
R7927:Kti12 UTSW 4 108848246 missense probably benign
R7927:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7929:Kti12 UTSW 4 108848246 missense probably benign
R7929:Kti12 UTSW 4 108848247 missense probably benign 0.00
R8099:Kti12 UTSW 4 108848374 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGATGCCCCTGGAGATCATG -3'
(R):5'- GGCAGGATTTCCTCTGGATC -3'

Sequencing Primer
(F):5'- TGGAGATCATGCCGCTCGTC -3'
(R):5'- GGATCCAGTTCCTTTGAGACAGC -3'
Posted On2020-08-07