Mutagenetix > Incidental Mutations

Incidental Mutation 'R0053:Ptprk'

64334

Institutional Source

Beutler Lab

Gene Symbol

Ptprk

Ensembl Gene

ENSMUSG00000019889

Gene Name

protein tyrosine phosphatase, receptor type, K

Synonyms

RPTPkappa, PTPk

MMRRC Submission

038347-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0053 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

28074820-28597397 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 28475109 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 533 (F533I)

Ref Sequence

ENSEMBL: ENSMUSP00000126279 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359]

Predicted Effect

probably damaging
Transcript: ENSMUST00000166468
AA Change: F533I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889
AA Change: F533I

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
MAM	30	193	1.61e-73	SMART
IG	200	288	2.16e-8	SMART
FN3	290	373	1.48e-4	SMART
FN3	389	475	4.24e1	SMART
FN3	491	579	3.32e-7	SMART
transmembrane domain	753	774	N/A	INTRINSIC
PTPc	898	1161	3.56e-132	SMART
PTPc	1190	1455	2.68e-86	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000218276
AA Change: F533I

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

probably damaging
Transcript: ENSMUST00000218359
AA Change: F533I

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218584

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218633

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219478

Meta Mutation Damage Score

0.1028

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.9%
20x: 96.5%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	T	A	6: 149,327,590	D711E	probably benign	Het
5730559C18Rik	C	T	1: 136,227,550	V106I	probably benign	Het
Ada	A	T	2: 163,732,292	V148D	probably damaging	Het
Alpi	T	C	1: 87,098,790	D493G	probably benign	Het
Atp10b	A	G	11: 43,216,564		probably benign	Het
AY761185	A	T	8: 20,944,530		probably benign	Het
BC067074	T	C	13: 113,368,489	W2051R	probably benign	Het
Cadm1	C	T	9: 47,799,414	T205I	probably damaging	Het
Capn3	A	G	2: 120,491,837	I413V	possibly damaging	Het
Cblb	C	T	16: 52,142,801	T369I	probably damaging	Het
Ccdc54	T	A	16: 50,590,234	N223I	probably benign	Het
Cdc25c	A	G	18: 34,735,435	V294A	probably benign	Het
Cep170	A	T	1: 176,782,380	S122T	possibly damaging	Het
Chd1	A	G	17: 15,747,189	N849D	probably damaging	Het
Dpp3	A	G	19: 4,923,126	C147R	probably damaging	Het
Dst	A	G	1: 34,294,550		probably null	Het
Fbxw9	T	A	8: 85,064,454	L250Q	probably damaging	Het
Gpr75	A	T	11: 30,892,571	Q492L	possibly damaging	Het
Gramd4	T	A	15: 86,130,138		probably benign	Het
Hivep2	T	C	10: 14,132,121	C1488R	probably damaging	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Insr	A	G	8: 3,155,683	S1369P	probably damaging	Het
Insrr	A	C	3: 87,800,452	D67A	probably damaging	Het
Irf2	T	A	8: 46,818,851	Y158N	probably benign	Het
Katnbl1	A	G	2: 112,404,241	R23G	probably benign	Het
Lamb2	T	A	9: 108,486,737	C987*	probably null	Het
Lzts2	T	C	19: 45,026,307		probably benign	Het
Mmp14	T	A	14: 54,438,652		probably benign	Het
Mycbpap	A	G	11: 94,511,736	Y258H	probably damaging	Het
Nav3	A	G	10: 109,766,917		probably benign	Het
Olfr1186	T	A	2: 88,526,163	N193K	probably damaging	Het
Olfr1406	T	C	1: 173,184,278	D52G	probably benign	Het
Parp10	T	A	15: 76,242,246	L247F	probably damaging	Het
Pcsk6	C	T	7: 65,983,703		probably benign	Het
Pgap3	A	T	11: 98,391,098	V129D	probably damaging	Het
Pibf1	A	G	14: 99,140,557	Y373C	probably damaging	Het
Plcb1	A	G	2: 135,294,915	E310G	probably benign	Het
Plin3	T	C	17: 56,279,892	D385G	probably damaging	Het
Pole	A	T	5: 110,293,340	D220V	probably damaging	Het
Rufy1	A	T	11: 50,401,465	M499K	probably benign	Het
Scn1a	T	G	2: 66,299,775	D1232A	probably benign	Het
Sec23ip	T	C	7: 128,745,167	L49P	probably damaging	Het
Sf3b1	G	A	1: 55,000,373	Q698*	probably null	Het
Shprh	A	T	10: 11,194,372		probably null	Het
Snd1	C	A	6: 28,745,335		probably benign	Het
Stab1	C	T	14: 31,140,687	A2260T	possibly damaging	Het
Stpg2	A	G	3: 139,212,321	Q60R	probably benign	Het
Strn	T	C	17: 78,656,934	H687R	possibly damaging	Het
Tgfb3	A	T	12: 86,077,829	I35N	probably damaging	Het
Tnks2	T	C	19: 36,875,365	S166P	probably damaging	Het
Tyw5	G	A	1: 57,401,438	T55M	probably damaging	Het
Usp19	A	G	9: 108,497,170		probably null	Het
Zfp13	A	T	17: 23,576,148	I483N	probably damaging	Het

Other mutations in Ptprk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00310:Ptprk	APN	10	28336510	missense	possibly damaging	0.92
IGL00533:Ptprk	APN	10	28585975	missense	probably damaging	0.97
IGL01062:Ptprk	APN	10	28580418	missense	probably damaging	1.00
IGL01295:Ptprk	APN	10	28475178	missense	probably benign	0.14
IGL01372:Ptprk	APN	10	28569927	missense	probably benign	0.00
IGL01452:Ptprk	APN	10	28574917	critical splice donor site	probably null
IGL01829:Ptprk	APN	10	28573387	missense	probably damaging	1.00
IGL01861:Ptprk	APN	10	28383445	missense	possibly damaging	0.80
IGL01955:Ptprk	APN	10	28595865	unclassified	probably benign
IGL02263:Ptprk	APN	10	28075114	missense	unknown
IGL02489:Ptprk	APN	10	28383472	missense	probably damaging	1.00
IGL02697:Ptprk	APN	10	28575618	missense	possibly damaging	0.85
IGL02713:Ptprk	APN	10	28592811	missense	possibly damaging	0.92
IGL02943:Ptprk	APN	10	28475176	missense	possibly damaging	0.81
IGL03240:Ptprk	APN	10	28492961	missense	probably damaging	0.99
IGL03373:Ptprk	APN	10	28566537	missense	probably damaging	1.00
LCD18:Ptprk	UTSW	10	28574987	intron	probably benign
PIT4366001:Ptprk	UTSW	10	28586019	missense	probably benign
R0010:Ptprk	UTSW	10	28585969	missense	probably damaging	1.00
R0021:Ptprk	UTSW	10	28592895	missense	probably damaging	1.00
R0021:Ptprk	UTSW	10	28592895	missense	probably damaging	1.00
R0035:Ptprk	UTSW	10	28263508	nonsense	probably null
R0035:Ptprk	UTSW	10	28263508	nonsense	probably null
R0063:Ptprk	UTSW	10	28263767	missense	probably damaging	1.00
R0063:Ptprk	UTSW	10	28263767	missense	probably damaging	1.00
R0244:Ptprk	UTSW	10	28206225	missense	possibly damaging	0.79
R0281:Ptprk	UTSW	10	28573392	missense	probably damaging	1.00
R0387:Ptprk	UTSW	10	28354629	missense	possibly damaging	0.66
R0480:Ptprk	UTSW	10	28585947	missense	probably damaging	1.00
R0480:Ptprk	UTSW	10	28585948	missense	probably damaging	1.00
R0585:Ptprk	UTSW	10	28575668	missense	probably damaging	1.00
R0614:Ptprk	UTSW	10	28075136	missense	probably damaging	0.96
R0684:Ptprk	UTSW	10	28483298	splice site	probably benign
R1073:Ptprk	UTSW	10	28496947	critical splice donor site	probably null
R1377:Ptprk	UTSW	10	28586026	missense	probably benign	0.42
R1422:Ptprk	UTSW	10	28475280	missense	possibly damaging	0.64
R1482:Ptprk	UTSW	10	28263516	missense	probably benign	0.24
R1532:Ptprk	UTSW	10	28585630	missense	probably damaging	1.00
R1576:Ptprk	UTSW	10	28551651	missense	probably damaging	1.00
R1618:Ptprk	UTSW	10	28493170	missense	probably benign	0.00
R1654:Ptprk	UTSW	10	28383647	missense	probably damaging	1.00
R1701:Ptprk	UTSW	10	28466058	missense	probably damaging	1.00
R1747:Ptprk	UTSW	10	28354692	missense	possibly damaging	0.78
R2033:Ptprk	UTSW	10	28592767	unclassified	probably benign
R2059:Ptprk	UTSW	10	28566603	missense	probably damaging	1.00
R2076:Ptprk	UTSW	10	28589368	missense	probably damaging	0.98
R2164:Ptprk	UTSW	10	28560142	missense	probably damaging	1.00
R2260:Ptprk	UTSW	10	28206149	missense	possibly damaging	0.65
R2394:Ptprk	UTSW	10	28551717	missense	probably damaging	0.98
R2432:Ptprk	UTSW	10	28592844	missense	probably damaging	1.00
R2437:Ptprk	UTSW	10	28354713	missense	probably damaging	1.00
R2495:Ptprk	UTSW	10	28475078	splice site	probably benign
R3037:Ptprk	UTSW	10	28580478	missense	probably damaging	1.00
R3162:Ptprk	UTSW	10	28592826	missense	probably benign
R3162:Ptprk	UTSW	10	28592826	missense	probably benign
R3687:Ptprk	UTSW	10	28473043	missense	probably damaging	1.00
R3722:Ptprk	UTSW	10	28383623	missense	probably damaging	1.00
R3892:Ptprk	UTSW	10	28263621	missense	probably benign	0.02
R3963:Ptprk	UTSW	10	28551665	missense	probably damaging	0.99
R4077:Ptprk	UTSW	10	28263512	missense	probably benign
R4079:Ptprk	UTSW	10	28263512	missense	probably benign
R4112:Ptprk	UTSW	10	28475288	critical splice donor site	probably null
R4255:Ptprk	UTSW	10	28206245	missense	probably benign	0.14
R4523:Ptprk	UTSW	10	28466052	missense	probably damaging	0.99
R4651:Ptprk	UTSW	10	28263690	missense	probably damaging	0.99
R4652:Ptprk	UTSW	10	28263690	missense	probably damaging	0.99
R4828:Ptprk	UTSW	10	28560054	missense	probably damaging	1.00
R4829:Ptprk	UTSW	10	28580484	nonsense	probably null
R4883:Ptprk	UTSW	10	28588932	missense	probably damaging	1.00
R5004:Ptprk	UTSW	10	28586063	missense	possibly damaging	0.95
R5013:Ptprk	UTSW	10	28551717	missense	probably damaging	0.99
R5092:Ptprk	UTSW	10	28592773	missense	probably damaging	1.00
R5126:Ptprk	UTSW	10	28575644	unclassified	probably null
R5183:Ptprk	UTSW	10	28475236	missense	probably benign	0.02
R5264:Ptprk	UTSW	10	28585586	missense	probably damaging	1.00
R5304:Ptprk	UTSW	10	28592054	splice site	probably null
R5330:Ptprk	UTSW	10	28587080	missense	probably damaging	1.00
R5474:Ptprk	UTSW	10	28496930	nonsense	probably null
R5516:Ptprk	UTSW	10	28496930	nonsense	probably null
R5796:Ptprk	UTSW	10	28383575	missense	probably damaging	1.00
R5843:Ptprk	UTSW	10	28493064	missense	probably damaging	0.99
R5952:Ptprk	UTSW	10	28585675	missense	probably damaging	0.99
R6065:Ptprk	UTSW	10	28475170	missense	probably damaging	1.00
R6226:Ptprk	UTSW	10	28564103	missense	probably benign	0.02
R6264:Ptprk	UTSW	10	28566673	missense	probably damaging	1.00
R6638:Ptprk	UTSW	10	28595811	missense	probably damaging	1.00
R6843:Ptprk	UTSW	10	28591982	missense	possibly damaging	0.86
R6860:Ptprk	UTSW	10	28334484	missense	probably damaging	1.00
R6869:Ptprk	UTSW	10	28473059	critical splice donor site	probably null
R7214:Ptprk	UTSW	10	28574909	missense	probably benign	0.11
R7307:Ptprk	UTSW	10	28589008	nonsense	probably null
R7349:Ptprk	UTSW	10	28592838	missense	possibly damaging	0.85
R7442:Ptprk	UTSW	10	28574819	missense	probably damaging	1.00
R7585:Ptprk	UTSW	10	28560088	missense	probably damaging	1.00
R7661:Ptprk	UTSW	10	28466040	missense	probably benign	0.00
R7694:Ptprk	UTSW	10	28589370	missense	possibly damaging	0.63
R7740:Ptprk	UTSW	10	28496924	missense	probably damaging	1.00
R7810:Ptprk	UTSW	10	28592857	missense	probably damaging	0.97
R7831:Ptprk	UTSW	10	28568408	missense	possibly damaging	0.89
R7836:Ptprk	UTSW	10	28573389	missense	probably damaging	1.00
R7914:Ptprk	UTSW	10	28568408	missense	possibly damaging	0.89
R7919:Ptprk	UTSW	10	28573389	missense	probably damaging	1.00
R8049:Ptprk	UTSW	10	28383569	missense	possibly damaging	0.84
Z1177:Ptprk	UTSW	10	28493120	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACTTGTATCCCTCTCCCAAGCAGTAT -3'
(R):5'- TGTTGCTGGTCCAAAGCCTTTGA -3'

Sequencing Primer
(F):5'- gaaagatgataggtgtgtaaagagag -3'
(R):5'- GTCCAAAGCCTTTGACAGTG -3'

Posted On

2013-08-06