Incidental Mutation 'R7927:Kti12'
ID643369
Institutional Source Beutler Lab
Gene Symbol Kti12
Ensembl Gene ENSMUSG00000073775
Gene NameKTI12 homolog, chromatin associated
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7927 (G1)
Quality Score999
Status Validated
Chromosome4
Chromosomal Location108847785-108849413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 108848247 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 119 (E119D)
Ref Sequence ENSEMBL: ENSMUSP00000099799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030296] [ENSMUST00000102738] [ENSMUST00000164855]
Predicted Effect probably benign
Transcript: ENSMUST00000030296
SMART Domains Protein: ENSMUSP00000030296
Gene: ENSMUSG00000028567

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
Pfam:Thioredoxin_7 37 118 1.1e-19 PFAM
Pfam:Thioredoxin 41 135 1.9e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102738
AA Change: E119D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099799
Gene: ENSMUSG00000073775
AA Change: E119D

DomainStartEndE-ValueType
Pfam:KTI12 1 347 3.3e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164855
SMART Domains Protein: ENSMUSP00000128780
Gene: ENSMUSG00000090551

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
low complexity region 47 64 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik T A 2: 91,421,905 D37V probably damaging Het
4921539E11Rik A G 4: 103,266,342 M111T probably benign Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Agrn C T 4: 156,172,809 G1188D probably damaging Het
Amz2 A G 11: 109,429,058 K90R probably damaging Het
Arhgef4 G T 1: 34,807,253 Q227H probably damaging Het
B4galt3 T A 1: 171,271,772 C10* probably null Het
Banf2 T A 2: 144,073,798 M53K probably benign Het
BC034090 A T 1: 155,241,625 L249* probably null Het
Cftr A G 6: 18,267,971 D673G possibly damaging Het
Cntnap2 G T 6: 47,095,687 C1063F possibly damaging Het
Dnah3 A G 7: 119,951,271 I296T probably damaging Het
Dpy19l2 A G 9: 24,695,901 V88A probably benign Het
Fbln5 T C 12: 101,818,388 probably benign Het
Fbn1 T C 2: 125,383,736 D532G possibly damaging Het
Fnta G A 8: 26,004,426 R258* probably null Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gch1 G A 14: 47,155,923 H201Y probably damaging Het
Gm13023 T A 4: 143,792,966 I99N probably benign Het
Grik2 A T 10: 49,240,794 S624T probably damaging Het
Grm5 T A 7: 88,036,174 S500T probably benign Het
Hmcn1 T A 1: 150,609,775 I4359F probably damaging Het
Hrc T A 7: 45,336,053 H209Q possibly damaging Het
Hsd17b14 T C 7: 45,565,971 M164T probably damaging Het
Hydin T C 8: 110,580,844 F3952L possibly damaging Het
Lig4 A T 8: 9,973,629 H50Q possibly damaging Het
Lrp6 G T 6: 134,520,550 R165S probably damaging Het
Muc4 A G 16: 32,771,637 T958A Het
Myo19 A G 11: 84,900,220 E419G probably damaging Het
Ndufa5 A G 6: 24,527,292 V16A possibly damaging Het
Olfr714 T C 7: 107,074,289 F154L probably benign Het
Phf24 A C 4: 42,934,774 T137P probably damaging Het
Pkp4 A T 2: 59,311,754 N467I probably damaging Het
Rbm12b2 C T 4: 12,095,417 R759C possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rnf34 T A 5: 122,850,225 probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCAGCGGCGGC 7: 97,579,924 probably benign Het
Scaf8 T A 17: 3,159,220 S73T unknown Het
Scn4a T A 11: 106,342,383 E454D probably damaging Het
Serpina1e A G 12: 103,951,191 V73A probably benign Het
Sh3rf2 A G 18: 42,111,422 T350A probably benign Het
Slc35a1 A G 4: 34,669,021 V264A probably damaging Het
Slf2 A G 19: 44,935,301 K185E probably damaging Het
Spsb2 T C 6: 124,809,373 F23S probably benign Het
Ssx2ip T G 3: 146,432,610 L404R probably damaging Het
Strn4 T A 7: 16,826,631 L236Q probably null Het
Tcp10b A G 17: 13,069,692 T202A probably benign Het
Tdp1 G T 12: 99,912,296 V448L probably damaging Het
Tecrl T C 5: 83,354,819 E61G probably damaging Het
Tepp T A 8: 95,313,158 S68T probably benign Het
Trim50 T C 5: 135,353,611 F106L probably benign Het
Usp5 G T 6: 124,824,229 F224L probably benign Het
Vmn2r45 C A 7: 8,483,514 M258I probably benign Het
Zfp574 T A 7: 25,080,147 V198E probably benign Het
Zmym4 A G 4: 126,905,377 I722T probably benign Het
Other mutations in Kti12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02608:Kti12 APN 4 108848162 missense probably damaging 1.00
IGL02891:Kti12 APN 4 108848533 missense probably benign
IGL03142:Kti12 APN 4 108848165 missense probably damaging 1.00
BB002:Kti12 UTSW 4 108848246 missense probably benign
BB002:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB003:Kti12 UTSW 4 108848246 missense probably benign
BB003:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB004:Kti12 UTSW 4 108848246 missense probably benign
BB004:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB006:Kti12 UTSW 4 108848246 missense probably benign
BB006:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB012:Kti12 UTSW 4 108848246 missense probably benign
BB012:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB013:Kti12 UTSW 4 108848246 missense probably benign
BB013:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB014:Kti12 UTSW 4 108848246 missense probably benign
BB014:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB016:Kti12 UTSW 4 108848246 missense probably benign
BB016:Kti12 UTSW 4 108848247 missense probably benign 0.00
R0518:Kti12 UTSW 4 108848579 missense possibly damaging 0.95
R1681:Kti12 UTSW 4 108848858 missense probably damaging 1.00
R5510:Kti12 UTSW 4 108848624 missense probably damaging 1.00
R5522:Kti12 UTSW 4 108848423 missense possibly damaging 0.58
R6652:Kti12 UTSW 4 108848533 missense probably benign 0.00
R6774:Kti12 UTSW 4 108848455 missense probably benign 0.12
R7123:Kti12 UTSW 4 108848482 missense probably benign 0.00
R7856:Kti12 UTSW 4 108848246 missense probably benign
R7856:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7858:Kti12 UTSW 4 108848246 missense probably benign
R7858:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7859:Kti12 UTSW 4 108848246 missense probably benign
R7859:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7914:Kti12 UTSW 4 108848246 missense probably benign
R7914:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7915:Kti12 UTSW 4 108848246 missense probably benign
R7915:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7916:Kti12 UTSW 4 108848246 missense probably benign
R7916:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7917:Kti12 UTSW 4 108848246 missense probably benign
R7917:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7918:Kti12 UTSW 4 108848246 missense probably benign
R7918:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7925:Kti12 UTSW 4 108848246 missense probably benign
R7925:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7926:Kti12 UTSW 4 108848246 missense probably benign
R7926:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7927:Kti12 UTSW 4 108848246 missense probably benign
R7929:Kti12 UTSW 4 108848246 missense probably benign
R7929:Kti12 UTSW 4 108848247 missense probably benign 0.00
R8099:Kti12 UTSW 4 108848374 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGAAGTTGACGCCAAACATC -3'
(R):5'- TCTGGATCCAGTTCCTTTGAG -3'

Sequencing Primer
(F):5'- ATGGATGCCCCTGGAGATCATG -3'
(R):5'- GGATCCAGTTCCTTTGAGACAGC -3'
Posted On2020-08-07