Incidental Mutation 'R0053:Atp10b'
ID64337
Institutional Source Beutler Lab
Gene Symbol Atp10b
Ensembl Gene ENSMUSG00000055415
Gene NameATPase, class V, type 10B
Synonyms5930426O13Rik, 9030605H24Rik
MMRRC Submission 038347-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R0053 (G1)
Quality Score179
Status Validated
Chromosome11
Chromosomal Location43149877-43262285 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 43216564 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000076844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077659]
Predicted Effect probably benign
Transcript: ENSMUST00000077659
SMART Domains Protein: ENSMUSP00000076844
Gene: ENSMUSG00000055415

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 47 118 3.8e-26 PFAM
Pfam:E1-E2_ATPase 123 393 2.9e-7 PFAM
low complexity region 621 638 N/A INTRINSIC
Pfam:Cation_ATPase 692 799 7.1e-9 PFAM
Pfam:HAD 705 1062 6.7e-12 PFAM
Pfam:PhoLip_ATPase_C 1079 1324 1.9e-79 PFAM
low complexity region 1353 1366 N/A INTRINSIC
low complexity region 1457 1471 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127604
Meta Mutation Damage Score 0.0552 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.5%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,327,590 D711E probably benign Het
5730559C18Rik C T 1: 136,227,550 V106I probably benign Het
Ada A T 2: 163,732,292 V148D probably damaging Het
Alpi T C 1: 87,098,790 D493G probably benign Het
AY761185 A T 8: 20,944,530 probably benign Het
BC067074 T C 13: 113,368,489 W2051R probably benign Het
Cadm1 C T 9: 47,799,414 T205I probably damaging Het
Capn3 A G 2: 120,491,837 I413V possibly damaging Het
Cblb C T 16: 52,142,801 T369I probably damaging Het
Ccdc54 T A 16: 50,590,234 N223I probably benign Het
Cdc25c A G 18: 34,735,435 V294A probably benign Het
Cep170 A T 1: 176,782,380 S122T possibly damaging Het
Chd1 A G 17: 15,747,189 N849D probably damaging Het
Dpp3 A G 19: 4,923,126 C147R probably damaging Het
Dst A G 1: 34,294,550 probably null Het
Fbxw9 T A 8: 85,064,454 L250Q probably damaging Het
Gpr75 A T 11: 30,892,571 Q492L possibly damaging Het
Gramd4 T A 15: 86,130,138 probably benign Het
Hivep2 T C 10: 14,132,121 C1488R probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Insr A G 8: 3,155,683 S1369P probably damaging Het
Insrr A C 3: 87,800,452 D67A probably damaging Het
Irf2 T A 8: 46,818,851 Y158N probably benign Het
Katnbl1 A G 2: 112,404,241 R23G probably benign Het
Lamb2 T A 9: 108,486,737 C987* probably null Het
Lzts2 T C 19: 45,026,307 probably benign Het
Mmp14 T A 14: 54,438,652 probably benign Het
Mycbpap A G 11: 94,511,736 Y258H probably damaging Het
Nav3 A G 10: 109,766,917 probably benign Het
Olfr1186 T A 2: 88,526,163 N193K probably damaging Het
Olfr1406 T C 1: 173,184,278 D52G probably benign Het
Parp10 T A 15: 76,242,246 L247F probably damaging Het
Pcsk6 C T 7: 65,983,703 probably benign Het
Pgap3 A T 11: 98,391,098 V129D probably damaging Het
Pibf1 A G 14: 99,140,557 Y373C probably damaging Het
Plcb1 A G 2: 135,294,915 E310G probably benign Het
Plin3 T C 17: 56,279,892 D385G probably damaging Het
Pole A T 5: 110,293,340 D220V probably damaging Het
Ptprk T A 10: 28,475,109 F533I probably damaging Het
Rufy1 A T 11: 50,401,465 M499K probably benign Het
Scn1a T G 2: 66,299,775 D1232A probably benign Het
Sec23ip T C 7: 128,745,167 L49P probably damaging Het
Sf3b1 G A 1: 55,000,373 Q698* probably null Het
Shprh A T 10: 11,194,372 probably null Het
Snd1 C A 6: 28,745,335 probably benign Het
Stab1 C T 14: 31,140,687 A2260T possibly damaging Het
Stpg2 A G 3: 139,212,321 Q60R probably benign Het
Strn T C 17: 78,656,934 H687R possibly damaging Het
Tgfb3 A T 12: 86,077,829 I35N probably damaging Het
Tnks2 T C 19: 36,875,365 S166P probably damaging Het
Tyw5 G A 1: 57,401,438 T55M probably damaging Het
Usp19 A G 9: 108,497,170 probably null Het
Zfp13 A T 17: 23,576,148 I483N probably damaging Het
Other mutations in Atp10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Atp10b APN 11 43202161 missense probably damaging 1.00
IGL01385:Atp10b APN 11 43234429 missense probably damaging 1.00
IGL01524:Atp10b APN 11 43259845 missense probably benign 0.18
IGL01575:Atp10b APN 11 43172721 missense probably benign 0.00
IGL01588:Atp10b APN 11 43172721 missense probably benign 0.00
IGL01590:Atp10b APN 11 43172721 missense probably benign 0.00
IGL01832:Atp10b APN 11 43234435 missense probably damaging 0.98
IGL01927:Atp10b APN 11 43259404 splice site probably benign
IGL01933:Atp10b APN 11 43194630 missense probably damaging 1.00
IGL02182:Atp10b APN 11 43248947 missense probably damaging 1.00
IGL02215:Atp10b APN 11 43194665 critical splice donor site probably null
IGL02216:Atp10b APN 11 43259789 missense probably damaging 0.98
IGL02973:Atp10b APN 11 43197509 missense probably damaging 1.00
IGL03012:Atp10b APN 11 43194655 missense probably damaging 0.99
IGL03106:Atp10b APN 11 43247477 missense probably benign 0.32
IGL03123:Atp10b APN 11 43153283 missense probably benign 0.01
IGL03202:Atp10b APN 11 43234441 critical splice donor site probably null
IGL03339:Atp10b APN 11 43230615 missense probably null 0.71
R0053:Atp10b UTSW 11 43216564 splice site probably benign
R0098:Atp10b UTSW 11 43189604 missense probably benign 0.00
R0098:Atp10b UTSW 11 43189604 missense probably benign 0.00
R0281:Atp10b UTSW 11 43153304 missense probably benign 0.00
R0379:Atp10b UTSW 11 43254314 missense probably benign 0.05
R0380:Atp10b UTSW 11 43225597 missense probably damaging 1.00
R0470:Atp10b UTSW 11 43203039 missense possibly damaging 0.88
R1355:Atp10b UTSW 11 43151655 nonsense probably null
R1368:Atp10b UTSW 11 43202154 missense probably damaging 1.00
R1370:Atp10b UTSW 11 43151655 nonsense probably null
R1413:Atp10b UTSW 11 43230564 missense probably benign 0.00
R1502:Atp10b UTSW 11 43230347 missense probably damaging 1.00
R1530:Atp10b UTSW 11 43197524 missense probably benign 0.03
R1596:Atp10b UTSW 11 43235767 missense probably damaging 1.00
R1675:Atp10b UTSW 11 43225648 missense probably damaging 1.00
R1880:Atp10b UTSW 11 43259432 missense probably damaging 1.00
R1938:Atp10b UTSW 11 43230418 missense probably benign 0.00
R1986:Atp10b UTSW 11 43172768 missense probably benign 0.12
R2081:Atp10b UTSW 11 43202128 missense probably damaging 1.00
R2083:Atp10b UTSW 11 43212423 missense probably benign 0.24
R2159:Atp10b UTSW 11 43151853 missense possibly damaging 0.81
R2255:Atp10b UTSW 11 43234380 missense probably damaging 1.00
R2259:Atp10b UTSW 11 43172745 missense probably damaging 1.00
R2259:Atp10b UTSW 11 43189613 missense probably damaging 1.00
R3741:Atp10b UTSW 11 43235662 missense probably damaging 1.00
R3942:Atp10b UTSW 11 43172754 missense probably damaging 1.00
R3971:Atp10b UTSW 11 43216512 missense probably damaging 1.00
R4007:Atp10b UTSW 11 43259852 missense probably benign 0.04
R4050:Atp10b UTSW 11 43259536 missense probably benign 0.00
R4078:Atp10b UTSW 11 43153283 missense probably benign 0.01
R4567:Atp10b UTSW 11 43197557 missense probably benign 0.03
R4651:Atp10b UTSW 11 43194645 missense probably damaging 1.00
R4652:Atp10b UTSW 11 43194645 missense probably damaging 1.00
R4667:Atp10b UTSW 11 43247518 missense probably damaging 1.00
R4720:Atp10b UTSW 11 43203122 missense probably benign
R4987:Atp10b UTSW 11 43151613 utr 5 prime probably benign
R5232:Atp10b UTSW 11 43202179 missense probably damaging 1.00
R5233:Atp10b UTSW 11 43230560 missense probably benign 0.06
R5281:Atp10b UTSW 11 43254336 missense probably damaging 0.97
R5307:Atp10b UTSW 11 43212475 missense probably damaging 1.00
R5460:Atp10b UTSW 11 43230455 missense probably benign 0.00
R5518:Atp10b UTSW 11 43151636 missense possibly damaging 0.84
R5659:Atp10b UTSW 11 43245425 missense probably damaging 1.00
R5688:Atp10b UTSW 11 43201173 missense probably benign 0.00
R5735:Atp10b UTSW 11 43151774 missense probably benign 0.00
R6153:Atp10b UTSW 11 43254282 missense probably damaging 1.00
R6251:Atp10b UTSW 11 43235746 missense possibly damaging 0.95
R6259:Atp10b UTSW 11 43201238 missense probably benign 0.24
R6394:Atp10b UTSW 11 43225637 missense probably damaging 1.00
R6492:Atp10b UTSW 11 43218957 missense probably damaging 1.00
R6769:Atp10b UTSW 11 43203252 critical splice donor site probably null
R6771:Atp10b UTSW 11 43203252 critical splice donor site probably null
R6775:Atp10b UTSW 11 43222213 missense possibly damaging 0.80
R7134:Atp10b UTSW 11 43245464 missense probably damaging 1.00
R7322:Atp10b UTSW 11 43212547 missense probably damaging 1.00
R7367:Atp10b UTSW 11 43247501 missense probably damaging 1.00
R7538:Atp10b UTSW 11 43225546 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGAAAGCCCTGATGAAGCAGCC -3'
(R):5'- CCACAGTGTGCTCTAGGATGTGAC -3'

Sequencing Primer
(F):5'- ACTAGTGTCTAGGACACCTGAGC -3'
(R):5'- ATGTTTTGGTAGAAAGAAGCCTG -3'
Posted On2013-08-06