Incidental Mutation 'R7928:Vmn1r203'
ID643438
Institutional Source Beutler Lab
Gene Symbol Vmn1r203
Ensembl Gene ENSMUSG00000069289
Gene Namevomeronasal 1 receptor 203
SynonymsV1rh11
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R7928 (G1)
Quality Score999
Status Validated
Chromosome13
Chromosomal Location22518114-22531992 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 22524535 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 162 (T162I)
Ref Sequence ENSEMBL: ENSMUSP00000089322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091729] [ENSMUST00000227520] [ENSMUST00000228889]
Predicted Effect probably benign
Transcript: ENSMUST00000091729
AA Change: T162I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000089322
Gene: ENSMUSG00000069289
AA Change: T162I

DomainStartEndE-ValueType
transmembrane domain 19 41 N/A INTRINSIC
Pfam:V1R 43 304 5.8e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227520
AA Change: T162I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000228889
AA Change: T162I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T A 15: 74,538,321 W270R probably damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
App A T 16: 84,978,246 V501D probably benign Het
Cnot6l A G 5: 96,131,068 V97A possibly damaging Het
Cntrob A G 11: 69,300,295 L831P probably damaging Het
Dmbt1 T C 7: 131,037,890 S53P probably benign Het
Dnah2 T C 11: 69,430,835 D3833G probably damaging Het
Dock4 T C 12: 40,788,303 L1081P probably damaging Het
Dock7 T C 4: 99,001,098 N185D Het
Dsn1 T C 2: 157,006,012 probably benign Het
Evpl T C 11: 116,222,533 T1444A possibly damaging Het
Fanci T C 7: 79,444,711 L1130P probably benign Het
Fancm A G 12: 65,106,124 D1118G unknown Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gm11596 A G 11: 99,792,796 V166A unknown Het
Gm2696 A T 10: 77,814,889 T70S unknown Het
Gm5773 A G 3: 93,773,690 E223G probably damaging Het
Madd T A 2: 91,176,888 D293V probably damaging Het
Odam A G 5: 87,887,410 T78A possibly damaging Het
Olfr629 T A 7: 103,741,190 I17F probably damaging Het
Rassf3 A G 10: 121,417,079 probably null Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rhbdf1 T C 11: 32,209,898 Y826C possibly damaging Het
Rnf13 C A 3: 57,764,308 Q14K probably benign Het
Sec13 A G 6: 113,729,640 S271P probably damaging Het
Sema6c T C 3: 95,172,309 L638P probably damaging Het
Sgsh T G 11: 119,347,735 H301P probably benign Het
Shh T C 5: 28,461,406 M161V possibly damaging Het
Son CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG 16: 91,656,841 probably benign Het
Stil C T 4: 115,030,001 H764Y probably damaging Het
Zfp950 G T 19: 61,119,500 P382T probably damaging Het
Zzef1 T C 11: 72,821,896 M214T probably damaging Het
Other mutations in Vmn1r203
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Vmn1r203 APN 13 22524777 missense probably damaging 1.00
IGL01527:Vmn1r203 APN 13 22524277 missense possibly damaging 0.89
IGL01808:Vmn1r203 APN 13 22524547 missense probably benign 0.02
IGL01887:Vmn1r203 APN 13 22524876 missense probably benign 0.00
IGL02340:Vmn1r203 APN 13 22524827 nonsense probably null
IGL02543:Vmn1r203 APN 13 22524904 missense probably damaging 1.00
IGL02684:Vmn1r203 APN 13 22524369 missense possibly damaging 0.95
BB005:Vmn1r203 UTSW 13 22524535 missense probably benign 0.01
BB015:Vmn1r203 UTSW 13 22524535 missense probably benign 0.01
PIT4519001:Vmn1r203 UTSW 13 22524595 missense probably benign 0.01
R0544:Vmn1r203 UTSW 13 22524273 missense possibly damaging 0.94
R1365:Vmn1r203 UTSW 13 22524586 missense probably benign 0.00
R1396:Vmn1r203 UTSW 13 22524508 missense probably benign 0.01
R1794:Vmn1r203 UTSW 13 22524351 missense probably damaging 1.00
R2010:Vmn1r203 UTSW 13 22524447 missense possibly damaging 0.56
R2169:Vmn1r203 UTSW 13 22524735 nonsense probably null
R2333:Vmn1r203 UTSW 13 22524943 missense probably damaging 1.00
R2418:Vmn1r203 UTSW 13 22524834 missense possibly damaging 0.57
R2419:Vmn1r203 UTSW 13 22524834 missense possibly damaging 0.57
R4322:Vmn1r203 UTSW 13 22524238 missense probably damaging 1.00
R4460:Vmn1r203 UTSW 13 22524682 missense probably damaging 0.98
R4686:Vmn1r203 UTSW 13 22524358 missense probably damaging 1.00
R5526:Vmn1r203 UTSW 13 22524103 missense probably benign 0.01
R6240:Vmn1r203 UTSW 13 22524729 missense possibly damaging 0.89
R6607:Vmn1r203 UTSW 13 22524721 missense probably benign 0.23
R7575:Vmn1r203 UTSW 13 22524418 missense probably benign 0.12
R8375:Vmn1r203 UTSW 13 22524984 makesense probably null
Z1177:Vmn1r203 UTSW 13 22524409 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGGCTGTAAGACCATTGTTTACC -3'
(R):5'- TCTGAAGGTAGAGGACATGCTG -3'

Sequencing Primer
(F):5'- GCTGTAAGACCATTGTTTACCTAGAG -3'
(R):5'- AGAGGACATGCTGGTGGTGC -3'
Posted On2020-08-07